BIOLOGY (LL)
5th Edition
ISBN: 9781264115495
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 14.4, Problem 1CS
Summary Introduction
To determine: The composition of a nucleosome with reference to figure 11.22 given in the text book.
Introduction: Nucleosome can be defined as repeating units of chromatin of eukaryotic organisms that are approximately eleven nanometers in diameter at its widest point.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Where does transcription take place?
nucleus
cytoplasm
ribosome
mitochondria
Why must transcription occur where DNA can be found?
because DNA can't leave
because ribosomes are in the nucleus
because DNA polymerase is found there
because helicase unzips the DNA
How many nucleotides equal 1 amino acid?
1
3
TRANSCRIBE this DNA sequence: TACGTTACT
AUGCAAUGA
ATGCAATGA
AUGGATUGA
TACGTTACT
É O O O O
O O O O
Macmillan Learning
Label the structural features of the yeast phenylalanine tRNA.
Answer Bank
region that carries the amino acid
at its end
Extra arm
5' end
region that contains the bases
ribothymidine and pseudouridine
region that contains the
base dihydrouridine
region that contains the anticodon,
which base pairs with the mRNA
Transcription
Know the central dogma
Where transcription takes place
What proteins are used for
Know how to make a complementary MRNA strand from DNA
Enzymes: RNA polymerase
Vocabulary: promoter
The steps of transcription (initiation, elongation, and termination)
What is the outcome of transcription?
Translation
Where translation takes place
Vocabulary: MRNA, TRNA, polypeptide, amino acid, codon, ribosomes
Know the start and stop codons
Be able to go from DNA->MRNA->codons->anticodons->amino acids
Know the tools for translation
The steps for translation
What are the steps of protein synthesis?
Chapter 14 Solutions
BIOLOGY (LL)
Ch. 14.1 - Prob. 1CCCh. 14.2 - Which genes are under the control of the lac...Ch. 14.2 - With regard to regulatory proteins and small...Ch. 14.2 - What were the key observations made by Jacob,...Ch. 14.2 - CoreSKILL What was the eventual hypothesis...Ch. 14.2 - Prob. 3EQCh. 14.2 - Core Skill: Connections Look back at Fig 9.12....Ch. 14.2 - What are the advantages of having both an...Ch. 14.2 - Prob. 2CSCh. 14.3 - Prob. 1CC
Ch. 14.4 - What are the two opposing effects that histone...Ch. 14.4 - Prob. 1CSCh. 14.5 - Prob. 1CCCh. 14.5 - Prob. 2CCCh. 14 - Prob. 1TYCh. 14 - Prob. 2TYCh. 14 - Transcription factors that bind to DNA and...Ch. 14 - Prob. 4TYCh. 14 - For the lac operon, what would be the expected...Ch. 14 - Prob. 6TYCh. 14 - The trp operon is considered _____ blank operon...Ch. 14 - Prob. 8TYCh. 14 - Prob. 9TYCh. 14 - _____ blank refers to the process that allows a...Ch. 14 - Prob. 1CQCh. 14 - Transcriptional regulation often involves a...Ch. 14 - Prob. 3CQCh. 14 - Discuss the advantages and disadvantages of...Ch. 14 - Discuss the advantages and disadvantages of...
Knowledge Booster
Similar questions
- topic: translation how is the growing polypeptide released from the ribosomal assembly?arrow_forwardExercise In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA, unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You will then need to convert your codons into amino acids in the 5' → 3' direction (translation). DNA strand 3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5' RNA strand 5'-AUG-AAU Amino acid sequence G ne (9)arrow_forwardLearning Task 3: TRACE THE CODE dentify the amino acids coded for by the MRNA codon using the Genetic Code Table below. Order of bases in mRNA (codon) AUC Order or bases Order of bases Amino acid Coded in DNA in tRNA into Proteins TAG CAT GC СА UAC Methionine Valine Procedures: Copy and fill in the table Refer to the Genetic Code table to identify the amino acid. To determine the order of bases in the first column (DNA), second column 1. 2. 3. (codon) and third column (anticodon), consider the complementary base pairs in DNA adenine pairs with thymine and guanine pairs with cytosine. 4 Example, AUG using the Genetic Code Table. Look for the first letter of the MRNA codon on the left side of the genetic code table (A). The second letter of the MRNA on the second letter column (U) and the third letter on the right-side column (G). AUG codes for the amino acid methionine. To identify the amino acid. Look at the bases in the MRNA codon. 5. Do the same with the other codons in the chart.…arrow_forward
- Please answer fast You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA made from that DNA and amplified it by PCR. You then determined the sequence of the cDNA obtained from different cells. You notice a difference. In the sequence obtained from DNA sequencing you see that a codon is 5' CAG however on the cDNA sequence it is TAG. These results are confirmed by repeated DNA sequence analysis using DNA and cDNA from different cell cultures (same species and tissue samples). What can explain this? a.The DNA must have been mutated in all the cells that were used to isolate mRNA since the cDNA should always match the genomic sequence. b.Any cDNA made through RT-PCR will have T's substitued for genomic C's that are methyulated. c.The mRNA must have been deaminated at the cytosine. d.The cDNA generated most likely had a technical mistake caused by poor fidelity of the Taq enzyme.arrow_forwardDate: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.arrow_forwardAKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.arrow_forward
- DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwardQuestion:- Define the transcription unit. How does it differ from the gene? Describe how you would determine the 5' and 3' ends of a transcription unit in a genome browser.arrow_forwardgive 2 examples of molecular machine except for replisome, transcriptome, ribosome and spliceosome.arrow_forward
- try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________arrow_forwardWorksheet (Nucleic Acid) Name: Section: Date: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter---- → CUU AUC UUU GAA UGA AUC UCG 2. TRNA (determined by matching letters (bases) with those in mRNA)--- GAA UAG AAA CUU ACU UAG BBEE B 3. Amino acids carried by L I P G I each tRNA (according to dictionary, below)-----------> e S h e 4. Symbols of amino acids:--→ L F Earrow_forwardI need help with a matching biology question: This is a single stranded molecule that in Eukaryotes passes from the nucleus to the cytoplasm. This makes up the ribosomal subunits and reads the mRNA. They carry amino acids during the process of translation. The structure is the site of translation. This is the enzyme complex that is used to copy DNA during transcription matched with: ribosome mRNA rRNA tRNA RNA polymerasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning