Referring to the locations of domains in the glucocorticoidreceptor relative to the amino- and carboxyl-terminal ends of the protein, make a drawing illustrating the binding of aglucocorticoid receptor dimer to the DNA. Label the amino and carboxyl ends, the hormone-binding domains, theDNA-binding domains, the dimerization domains, and the transactivationdomains. Introduction: In the function of glucocorticoid receptor, smaller domains like transactivation domain, DNA binding domain, and hormone binding domain play specific functional roles. For example, the carboxy terminal portion contains a domain that functions as a glucocorticoid binding site. The locations of domains in the glucocorticoid receptor relative to the amino and carboxyl terminal ends of the protein can be used to draw a hypothetical diagram of a glucocorticoid receptor dimer bound to the DNA.

Question

Want to see the full answer?

Answer 1

Question

Chapter 15, Problem 16CONQ

Summary Introduction

To analyze:

Referring to the locations of domains in the glucocorticoidreceptor relative to the amino- and carboxyl-terminal ends of the protein, make a drawing illustrating the binding of aglucocorticoid receptor dimer to the DNA. Label the amino and carboxyl ends, the hormone-binding domains, theDNA-binding domains, the dimerization domains, and the transactivationdomains.

Introduction:

In the function of glucocorticoid receptor, smaller domains like transactivation domain, DNA binding domain, and hormone binding domain play specific functional roles. For example, the carboxy terminal portion contains a domain that functions as a glucocorticoid binding site. The locations of domains in the glucocorticoid receptor relative to the amino and carboxyl terminal ends of the protein can be used to draw a hypothetical diagram of a glucocorticoid receptor dimer bound to the DNA.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Question:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'

Question 3 Review transcription. Match the term and its description. Each term can only be used once. RNA synthesis is catalyzed by this enzyme called | Choose ) The DNA sequence where RNA polymerase attaches is called | Choose | In bacteria, the sequence signaling the end of transcription is called | Choose J The stretch of DNA that is transcribed is called | Choose | These factors mediate the binding of RNA polymerase and the | Choose initiation of transcription > > >

Complete the following problems. 1. Draw a molecule of phosphatidyl serine using palmitic acid and linoleic (Δ9,12) acid 2. Consider the following coding strand sequence of DNA to a corresponding amino acid sequence. This represents the first amino acids to be translated. Underline the codon where translation will be initiated, and give the amino acid sequence of the peptide produced. 5’-CGATGCTCAAGTTTC-3’ 3. Within the matrix of the mitochondria, the pH is approximately 6.8 ([H+] = 1.6 X 10-7), while it is 7.4 ([H+] = 4.0 X 10-8) in the intermembrane space outside the matrix. Calculate the free energy driving transport of hydrogen ions from the intermembrane space to the matrix. Remember to include both the concentration and the membrane potential factors. 4. Draw the adenosine-5’-diphosphate.