![Genetics: Analysis and Principles](https://www.bartleby.com/isbn_cover_images/9780073525341/9780073525341_largeCoverImage.gif)
Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 15CONQ
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few dozen genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen genes.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a
protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you
introduce the nucleotide sequence encoding the NLS into the gene that encodes the
cytoplasmic protein of interest.
a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain.
5'
3'
b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in
the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of
the protein, at which location (A-E) should the NLS be inserted? Briefly explain.
A
TATAA
ATATT
promoter
+1
B
ATG
TAC
D
TAA
ATT
stop
codon
E
3'
5'
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
Chapter 15 Solutions
Genetics: Analysis and Principles
Ch. 15.1 - 1. Combinatorial control refers to the phenomenon...Ch. 15.1 - 2. A regulatory transcription factor protein...Ch. 15.1 - 3. A bidirectional enhancer has the following...Ch. 15.1 - 4. Regulatory transcription factors can be...Ch. 15.2 - 1. A chromatin-remodeling complex may
a. change...Ch. 15.2 - Prob. 2COMQCh. 15.2 - 3. Which of the following characteristics is...Ch. 15.2 - 4. Transcriptional activation of eukaryotic genes...Ch. 15.3 - How can methylation affect transcription? a. It...Ch. 15.3 - 2. The process in which completely unmethylated...
Ch. 15.4 - Prob. 1COMQCh. 15.5 - The overall goal of the ENCODE Project is a. to...Ch. 15 - Discuss the common points of control in eukaryotic...Ch. 15 - 2. Discuss the structure and function of...Ch. 15 - 3. What is meant by the term transcription factor...Ch. 15 - What are the functions of transcriptional...Ch. 15 - 5. Is each of the following statements true or...Ch. 15 - 6. Transcription factors usually contain one or...Ch. 15 - Prob. 7CONQCh. 15 - Prob. 8CONQCh. 15 - 9. Let’s suppose a mutation in the glucocorticoid...Ch. 15 - Prob. 10CONQCh. 15 - Prob. 11CONQCh. 15 - Prob. 12CONQCh. 15 - 13. Transcription factors such as the...Ch. 15 - An enhancer, located upstream from a gene, has the...Ch. 15 - 15. The DNA-binding domain of each CREB protein...Ch. 15 - The gene that encodes the enzyme called tyrosine...Ch. 15 - Prob. 16CONQCh. 15 - Prob. 18CONQCh. 15 - 18. What is a histone variant?
Ch. 15 - Prob. 20CONQCh. 15 - 20. What is meant by the term histone code? With...Ch. 15 - Prob. 22CONQCh. 15 - Histones are thought to be displaced as RNA...Ch. 15 - 23. What is an insulator? Describe two different...Ch. 15 - 24. What is DNA methylation? When we say that DNA...Ch. 15 - Lets suppose that a vertebrate organism carries a...Ch. 15 - 26. What is a CpG island? Where would you expect...Ch. 15 - 1. Briefly describe the method of chromatin...Ch. 15 - Researchers can isolate a sample of cells, such as...Ch. 15 - Prob. 3EQCh. 15 - Prob. 4EQCh. 15 - Prob. 5EQCh. 15 - 6. As described in Chapter 21, an electrophoretic...Ch. 15 - 1. Explain how DNA methylation could be used to...Ch. 15 - 2. Enhancers can occur almost anywhere in DNA and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)arrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forward
- The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forward
- Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forwardThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forward
- Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardA 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License