![Genetics: Analysis and Principles](https://www.bartleby.com/isbn_cover_images/9780073525341/9780073525341_largeCoverImage.gif)
Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15.1, Problem 2COMQ
A regulatory transcription factor protein typically contains _________ that binds to the ________ of the DNA.
a. an
helix, backbone
b. an
helix, major groove
c. a
sheet, backbone
d. a
sheet, major groove
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Tightly coiled DNA is ________.
a.
known as hypermethylated
b.
translationally regulated
c.
transcriptionally inactive
Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ direction
tRNAs contain the ________ that interacts with mRNA.
a.
docking bay
b.
anticodon
c.
codon
Chapter 15 Solutions
Genetics: Analysis and Principles
Ch. 15.1 - 1. Combinatorial control refers to the phenomenon...Ch. 15.1 - 2. A regulatory transcription factor protein...Ch. 15.1 - 3. A bidirectional enhancer has the following...Ch. 15.1 - 4. Regulatory transcription factors can be...Ch. 15.2 - 1. A chromatin-remodeling complex may
a. change...Ch. 15.2 - Prob. 2COMQCh. 15.2 - 3. Which of the following characteristics is...Ch. 15.2 - 4. Transcriptional activation of eukaryotic genes...Ch. 15.3 - How can methylation affect transcription? a. It...Ch. 15.3 - 2. The process in which completely unmethylated...
Ch. 15.4 - Prob. 1COMQCh. 15.5 - The overall goal of the ENCODE Project is a. to...Ch. 15 - Discuss the common points of control in eukaryotic...Ch. 15 - 2. Discuss the structure and function of...Ch. 15 - 3. What is meant by the term transcription factor...Ch. 15 - What are the functions of transcriptional...Ch. 15 - 5. Is each of the following statements true or...Ch. 15 - 6. Transcription factors usually contain one or...Ch. 15 - Prob. 7CONQCh. 15 - Prob. 8CONQCh. 15 - 9. Let’s suppose a mutation in the glucocorticoid...Ch. 15 - Prob. 10CONQCh. 15 - Prob. 11CONQCh. 15 - Prob. 12CONQCh. 15 - 13. Transcription factors such as the...Ch. 15 - An enhancer, located upstream from a gene, has the...Ch. 15 - 15. The DNA-binding domain of each CREB protein...Ch. 15 - The gene that encodes the enzyme called tyrosine...Ch. 15 - Prob. 16CONQCh. 15 - Prob. 18CONQCh. 15 - 18. What is a histone variant?
Ch. 15 - Prob. 20CONQCh. 15 - 20. What is meant by the term histone code? With...Ch. 15 - Prob. 22CONQCh. 15 - Histones are thought to be displaced as RNA...Ch. 15 - 23. What is an insulator? Describe two different...Ch. 15 - 24. What is DNA methylation? When we say that DNA...Ch. 15 - Lets suppose that a vertebrate organism carries a...Ch. 15 - 26. What is a CpG island? Where would you expect...Ch. 15 - 1. Briefly describe the method of chromatin...Ch. 15 - Researchers can isolate a sample of cells, such as...Ch. 15 - Prob. 3EQCh. 15 - Prob. 4EQCh. 15 - Prob. 5EQCh. 15 - 6. As described in Chapter 21, an electrophoretic...Ch. 15 - 1. Explain how DNA methylation could be used to...Ch. 15 - 2. Enhancers can occur almost anywhere in DNA and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- During transcription, 1 nucleotide of DNA corresponds with ________ nucleotide of RNA: A. 1 B. 2 C. 3 D. 4arrow_forwardTermination of translation occurs when the ribosome reaches one of _____ potential stop codons. At this point a ________ enters the ________ site of the ribosome and the polypeptide chain is terminated. a. 4; protein release factor; P b. 3; protein release factor; P c. 3; protein release factor; A d. 4; modified tRNA release factor; P e. 3; modified tRNA release factor; A f. 4; modified tRNA release factor; Aarrow_forwardIn RNA, ___________ pairs with adenine. A.Group of answer choices cytosine guanine thymine uracil B.The main differences between introns and exon is Group of answer choices Exons code for amino acids and Introns do not Introns code for RNA and exons code for DNA Introns code for amino acids and exons do not Introns enter the nucleus and exons leave the nucleusarrow_forward
- _____ is the combination of a seat, elation, another modifications to the histones that allow for changes in DNA winding and unwinding a. Epigentics b. Histone code c. Heterochromatin d. Post translational modificationsarrow_forwardA DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACTarrow_forwardThe binding of ________ is required for transcription to start. a. a protein b. DNA polymerase c. RNA polymerase d. a transcription factorarrow_forward
- A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AGU GUC UUU GAC b. UCU CUG UUU CAG UCA CAG AAA CUG d. TCA CAG AAA CTG C. How many amino acids does the mRNA strand above code for? .arrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forwardA particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The corresponding codon for the mRNA is _________ (write 5’ --> 3). B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________arrow_forward
- The genetic code is based on four different bases with the structures shown here. Determine the hybridization in each interior atom in these four bases. a. cytosine b. adenine c. thymine d. guanine NH2 H HC SCH HC H NH2 a. b. H HC HN1 8CH NH H;C H2N H d.arrow_forward_______is/are removed from a new mRNA. a. Introns c. A poly-A tail b. Exons d. Amino acidsarrow_forward______is a function of the large ribosomal subunit A.endonucleasE B.tRNA transferase C. phosphorylase D.Transcription initiation E. peptidyl transferasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY