Concept explainers
DNA methylation is commonly associated with a reduction of transcription. The following data come from a study of the impact of the location and extent of DNA methylation on gene activity in human cells. A bacterial gene, luciferase, was cloned next to eukaryotic promoter fragments that were methylated to various degrees, in vitro. The chimeric plasmids were then introduced into tissue culture cells, and the luciferase activity was assayed. These data compare the degree of expression of luciferase with differences in the location of DNA methylation(Irvine et al., 2002. Mol and Cell Biol 22: 6689–6696). What general conclusions can be drawn from these data?
DNA Segment | Patch Size of Methylation (kb) |
Number of Methylated CpGs | Relative Luciferase Expression |
Outside transcription | 0.0 | 0 | 490
|
unit (0–7.6 kb away) | 2.0 | 100 | 290
|
3.1 | 102 | 250
|
|
12.1 | 593 | 2
|
|
Inside transcription unit | 0.0 | 0 | 490
|
1.9 | 108 | 80
|
|
2.4 | 134 | 5
|
|
12.1 | 593 | 2
|
Want to see the full answer?
Check out a sample textbook solutionChapter 15 Solutions
Mastering Genetics with Pearson eText -- Standalone Access Card -- for Essentials of Genetics (9th Edition)
- To identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forward#3) Ligase catalyzes a reaction between the 5' phosphate and the 3' hydroxyl groups at the end of DNA molecules. The enzyme calf intestinal phosphatase catalyzes the removal of the 5' phosphate from DNA molecules. What would be the consequence of treating a cloning vector, before ligation, with calf intestinal phosphatase?arrow_forwardDNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is relieved by DNA gyrase. Supercoiling may also be involved in transcription regulation. Researchers discovered that enhancers operating over a long distance (2500 bp) are dependent on DNA supercoiling, while enhancers operating over shorter distances (110 bp) are not so dependent [Liu et al. (2001). Proc. Natl. Acad. Sci. USA 98:14,883–14,888]. Using a diagram, suggest a way in which supercoiling may positively influence enhancer activity over long distances.arrow_forward
- Transfer RNA in eukaryotic cells is synthesized by which of the following enzymes (sensitive to high concentrations of the fungal poison a-amanitin, but not to low concentrations)? RNA polymerase I DNA polymerase I RNA polymerase II DNA polymerase II RNA polymerase III Which of the following processes of genetic information flow can occur under laboratory conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)arrow_forwardA temperature-sensitive mutation is one in which the defect is not presented functionally until the temperature is raised. In the case described below, the enzymes function normally in bacteria at 37 °C, but are non-functional at 40 °C. Predict the detailed molecular consequences of a loss of function in a temperature-sensitive mutant for each of the following enzymes: a) DNA gyrase, b) DNA polymerase III, c) DNA ligase, d) DNA polymerase I.arrow_forwardWhen a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?arrow_forward
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forwardYou want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA encodes an mRNA of 100 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true.arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forward
- Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardCodon optimization is a widely used process for recombinant expression in prokaryotic systems. Regarding this process, mark the incorrect alternative. * A)increases the overall yield of expression of recombinant proteins. B)prevents the formation of truncated proteins. C)increases the frequency of tRNAs that recognize rare codons. D)does not interfere with the primary sequence of the recombinant protein.arrow_forwardOchre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney Brenner, Anthony O. Stretton, and Samuel Kaplan applied different types of mutagens to bacteriophages in an attempt to determine the bases present in the codons responsible for amber and ochre mutations. They knew that the ochre and amber mutations were suppressed by different types of suppressor mutations, which demonstrated that each is a different stop codon. They obtained the following results: (1) A single-base substitution could convert an ochre mutation into an amber mutation. (2) Hydroxylamine induced both ochre and amber mutations in wildtype phages. (3) 2-Aminopurine caused ochre to mutate to amber. (4) Hydroxylamine did not cause ochre to mutate to amber. These data do not allow the complete nucleotide sequence of the amber and ochre codons to be worked out, but they do provide some information about the bases found in the nonsense mutations. a. What conclusions about the…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education