EBK BIOLOGY
11th Edition
ISBN: 8220102797352
Author: Raven
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 3S
Describe how each of the following mutations will affect the final protein product (protein begins with start codon). Name the type of mutation.
Original template strand:
3′ – CGTTACCCGACCGTACGATTAGG–5′
3′ – CGTTACCCGAGCCGTAACGATTAGG –5′
3′ – CGTTACCCGATCCGTACGATTAGG –5′
3′ – CGTTACCCGAGCCGTTCGATTAGG –5′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene.
123456789
5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3
a. Write the template DNA (complementary strand) sequence for the wild type gene above
b. Write the DNA sequence of the mutant gene (Both DNA strands)
c. Write the sequence of mRNA produced from the mutant gene
d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
Consider the following DNA template:
5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’
3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’
If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation.
Met-Ala-Leu-Thr-Gln-Glu-Gly
Met-Gly-Ser-Leu-Asn-Ser-Gln
Met-Thr-Asn-Ser-Leu-Ala-Gln
Met-Gln-Ala-Leu-Thr-Asn-Ser
Met-Glu-Ala-His-Trp-Ser-Tyr
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
Chapter 15 Solutions
EBK BIOLOGY
Ch. 15 - The experiments with nutritional mutants in...Ch. 15 - What is the central dogma of molecular biology? a....Ch. 15 - In the genetic code, one codon a. consists of...Ch. 15 - Eukaryotic transcription differs from prokaryotic...Ch. 15 - An anticodon would be found on which of the...Ch. 15 - RNA polymerase binds to a ________ to initiate...Ch. 15 - During translation, the codon in mRNA is actually...Ch. 15 - You have mutants that all affect the same...Ch. 15 - The splicing process a. occurs in prokaryotes. b....Ch. 15 - The enzyme that forms peptide bonds is called...
Ch. 15 - In comparing gene expression in prokaryotes and...Ch. 15 - The codon CCA could be mutated to produce a. a...Ch. 15 - An inversion will a. necessarily cause a mutant...Ch. 15 - What is the relationship between mutations and...Ch. 15 - Prob. 1SCh. 15 - Frameshift mutations often result in truncated...Ch. 15 - Describe how each of the following mutations will...Ch. 15 - There are a number of features that are unique 10...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forwardThe following bacterial DNA sequence uses the top strand as the coding strand and the bottom strand as the template strand. Write what the messenger RNA sequence for this gene would be after transcription occurs.arrow_forward
- Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardFor each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.arrow_forward
- The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardWhich of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?arrow_forward
- Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letterarrow_forwardTranscribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY