EBK CAMPBELL BIOLOGY IN FOCUS
2nd Edition
ISBN: 8220101459299
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 9TYU
FOCUS ON EVOLUTION
DNA sequences can act as “tape measures of evolution” (see Concept 3. 7).evolution.” Some highly conserved regions of the human genome (similar to comparable regions in other species) don't code for proteins. Propose a possible explanation
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
3.
Analyzing the Molecules of Life - Molecular Diagnostics
An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red):
CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG
UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC
ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA
CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA
RT-qPCR can be used to detect the variant (mutation).
(a)
In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR,
and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule
as shown at 37 °C.
(b)
Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that
the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated
Tm.
Signal Village National High
Learning Activity Sheet
Heredity: Inheritance and Variation
Science 10 Third Quarter-Week 4
ALME N
Grade and Section
Name of Student
Name of Teacher
Let's Explore
This module we will be discussing about the DNA and mRNA and its role in performing a very
important task of transferring codes to proteins that will be manifested in the body. But first, let's have
this quick activity to get to know DNA ad mRNA well.
LET US PAIR!
The sequence of bases in one DNA / RNA (indicated per item) strand is given below. Identify the
complementary sequence of bases in the other strand of DNA/RNA. The first one is done for you.
DNA
RNA
A always pairs with T
A always pairs with U
C aiwayspairs with G
C always p airs with G
DNA:
1. DNA:
2. RNA:
G.
3. DNA:
A
4. RNA:
G.
G.
SIGNAL
Molecular Biology (Biol-L211)
Dr. Nole
Central Dogma Practice - Processes
The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is
represented by each item in the diagram and clearly address each of the following.
A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA.
B. Label each arrow to indicate which is processing, transcription, replication, and translation.
C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence.
D. Identify the specific location of the place where the start codon and stop codon function most directly.
E. Where does RNA polymerase bind to begin transcription?
F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where
are they found?
G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3',
5', C-terminus, and N-terminus.)
Chapter 15 Solutions
EBK CAMPBELL BIOLOGY IN FOCUS
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Describe the role of complementary base pairing...Ch. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
The term ‘spore’.
Biology Science Notebook
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…arrow_forward1. What are the 4 crucial characteristics of genetic material? Briefly describe how why each characteristic is applicable to DNA. 2. The following questions are about gene transcription and translation. a. Use the nucleotide sequence TGA CTA ACG GCT, transcribe into mRNA, and translate into a protein. b. Using this sequence, give an example of a synonymous, a non- synonymous and indel mutation. c. Which will have the biggest impact on protein evolution?arrow_forwardJunk DNA — Not So Useless After All | TIME.com What was the scientist's error in naming noncoding DNA “junk” DNA. Is the amount of DNA an organism has correlated to intelligence or complexity? What are two discovered uses of noncoding DNA (introns)?arrow_forward
- When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?arrow_forwardDiagram the central dogma of molecular biology (biological information flow) and include RNA processing in your diagram.arrow_forwardX ⒸCP Biology 2022-2023 Unit 7 Pro X + app.formative.com/formatives/63403369f912f69144853e8b 3 Messenger RNA (mRNA) Codes for Selected Amino Acids Amino Acid mRNA Code Leucine C-C-A Arginine C-G-A Phenylalanine U-U-U G-U-U A-A-A e here to search Valine Lysine О 1¹ b Valine Leucine 3 aarrow_forward
- SAY IT WITH DNA: PROTEIN SYNTHESIS WORKSHEET: Practice Pays Student Handout Having studied the process by which DNA directs the synthesis of proteins, you should be ready to decode some DNA "secret" messages. To do this, you must follow the procedure of protein synthesis as this is taking place right now in your cells; no short cuts! Practice these steps by following and finishing the partially solved message below. STEP 1: "Build" the mRNA molecule, matching the RNA nucleotides to the DNA nucleotides properly, letter by letter. (For purposes of simplicity, it will be assumed that this mRNA is bacterial; there are no introns to cut out!) STEP 2: Figure out the tRNA triplets (codons) that would fit the mRNA triplets (letter by letter). STEP 3: Look up each tRNA codon in the tRNA Dictionary (below), and find the corresponding symbol and amino acid abbreviation for that codon. Record that one-letter symbol (and its amino acid) below each codon. "Spc" = "space". If you have done this…arrow_forwardWhat is the Central Dogma of biology?•. Name FOUR polymers in your body rightnOW.‡. DRAW the new DNA codon for your NEWamino acid (5'-3")gDRAW the new mRNA codon for yournew amino acid (5'-3°).arrow_forwardPlease answer fast You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA made from that DNA and amplified it by PCR. You then determined the sequence of the cDNA obtained from different cells. You notice a difference. In the sequence obtained from DNA sequencing you see that a codon is 5' CAG however on the cDNA sequence it is TAG. These results are confirmed by repeated DNA sequence analysis using DNA and cDNA from different cell cultures (same species and tissue samples). What can explain this? a.The DNA must have been mutated in all the cells that were used to isolate mRNA since the cDNA should always match the genomic sequence. b.Any cDNA made through RT-PCR will have T's substitued for genomic C's that are methyulated. c.The mRNA must have been deaminated at the cytosine. d.The cDNA generated most likely had a technical mistake caused by poor fidelity of the Taq enzyme.arrow_forward
- A gene affecting the behavioral outlook of individuals was discovered in several humans who can overcome anxiety caused by life's problems. Part of the gene that į translated into protein has a sequence 3'-GGATCCCGAATGTAATGCGTGCTC AATGGTAGTACGGC-5'. 1. What is the complementary strand of the DNA? 2. What is the sequence of the MRNA product after translation? 3. What is the sequence of the peptide encoded by the portion of the gene? (Use one letter symbol of amino acids)arrow_forwardPractice HW make a nucleotide sequence (Template strand and Coding strand) of at least 15 base pairs for each of these steps to show your understanding of how genetic information is stored and used within a cell make sure that there are start and stop positions and note the direction of the sequence--- 5’ to 3’ or 3’ to 5.arrow_forwardThe RNA World Hypothesis suggests that the earliest forms of life used RNA as a genome instead of DNA. Why then do we not see organisms alive today with RNA genomes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License