Campbell Biology In Focus
2nd Edition
ISBN: 9780134203072
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 15.2, Problem 3CC
Summary Introduction
To interpret:
The results that an individual must expect to obtain when he compares the
Introduction:
The distal control elements are located upstream or downstream within a gene or introns. Control elements (non-coding DNA) serves as binding sites for the transcription factors. It plays a major role to regulate transcription.
Distal control elements or enhancer are located far away from a gene. It presents upstream genes into a DNA and it also contains some regulatory elements.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
Strength
22. You are analyzing a new human neuronal enhancer.
You cloned the enhancer in front of a minimal promoter,
transfected a neuronal cell line, and quantified GFP
expression. You then performed the deletion analysis
shown on the right. Which letter designates the minimal
region where enhancer activity is located?
min.
Novel enhancer
prom. GFP
of expression
+++
+/-
+++
+/-
+++
a. a
b. b
C. C
+++
+/-
d. d
e. both b and c are needed
protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short
guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently
sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume
that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of
Gene Y is necessary for Gene Ys function.
a. Liver: Functional Gene Y; Brain: Functional Gene Y
b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y
c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y
d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Y
Chapter 15 Solutions
Campbell Biology In Focus
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Describe the role of complementary base pairing...Ch. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. How many enhancers were you able to identify with these set of experiments? Explain. b. If you find any enhancer, in what genetic region, number of base pairs upstream from MRPA, are they located? Explain.arrow_forwardWHAT IF? Since the results support a role for mouse FOXP2 invocalization, you might wonder whether the human FOXP2 protein is akey regulator of speech. If you were given the amino acid sequences ofwild-type and mutant human FOXP2 proteins and the wild-type chimpanzee FOXP2 protein, how would you investigate this question? What furtherclues could you obtain by comparing these sequences to that of the mouseFOXP2 protein?arrow_forward1. - Which factor(s)/protein(s) would you expect to occur at positions C and G ? (name them) 2. - Would you expect e1, e2, or e3 to be an enhancer for gene t? (explain briefly) 3. - Which genes would you expect to be most likely regulated by enhancer e1? (explain briefly) 4. - In this example genes t - x are expressed but genes y and z are not transcribed. At which position would you expect to see a sharp transition between the chromatin marks H3K27me3 and H3K36me3? (name the position, A - I).arrow_forward
- . What is an enhanceosome? Why could a mutation in anyone of the enhanceosome proteins severely reduce thetranscription rate?arrow_forwardAlignment of protein sequences from the HOX gene family identifies a highly conserved domain in the C-terminal part of the protein that is a domain (one acronym and one word). Although Hox genes have important roles during embryogenesis and tissue differentiation, the different HOX proteins bind to very similar DNA (one word) that are rich in the bases and (one word each). To ensure high affinity binding to (one acronym) and specific regulation of target (one word), the HOX proteins form complexes with (two words).arrow_forwardBased on the given scenario, tell whether structural genes are expressed (YES) or not expressed (NO) 1. LacY is deleted (YES/NO) 2. LacI is deleted (YES/NO) 3. TrpR is deleted (YES/NO) 4. Promoter sequence is deleted (YES/NO) 5. lactose is present in the environment; glucose is absent (YES/NO) 6. tryptophan is absent in the environment (YES/NO) 7. operator is deleted (YES/NO)arrow_forward
- Enhancer RPA Gene A Use the diagram above, which depicts a chromosomal region less than 500,000 bp, to determine the expression of each gene under the scenarios specified in the table. Regulatory promoters are indicated by "RP". Genes A, B, and C have intermediate expression when no regulatory proteins are bound. Complete the table by choosing high, intermediate, or low to describe the expression level of each gene under each specified scenario (i and ii). No regulatory proteins bound (i) A repressor binds to RPA and an activator binds to RPC (ii) A regulatory protein binds at each of the activator, insulator, and silencer. Expression of A? Intermediate 1. [Select] 4. [Select] Insulator RPB Expression of B? 2. Gene B Intermediate 5. [Select] [Select] Silencer RPC Expression of C? 3. Gene C Intermediate 6. [Select] [Select]arrow_forward. An interesting mutation in lacI results in repressorswith 110-fold increased binding to both operator andnonoperator DNA. These repressors display a “reverse”induction curve, allowing β-galactosidase synthesis inthe absence of an inducer (IPTG) but partly repressingβ-galactosidase expression in the presence of IPTG. Howcan you explain this? (Note that, when IPTG binds a repressor, it does not completely destroy operator affinity,but rather it reduces affinity 110-fold. Additionally, ascells divide and new operators are generated by thesynthesis of daughter strands, the repressor must findthe new operators by searching along the DNA, rapidlybinding to nonoperator sequences and dissociating fromthem.)arrow_forwardSequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.arrow_forward
- Discuss the method and experiments where Simplifying Protein Expression with myTXTL is usedarrow_forwardHow can one most effectively silence the myofilament gene unc-22 in C. elegans to produce the twitching phenotype? O A. Screen thousands of strains for a spontaneous unc-22 mutation O B. Soak worms in mutagenic solutions of EMS and screen the progeny OC. Inject antisense strands of unc-22 RNA into worm ovaries, which will be taken up by germ line cells and expressed in progeny O D. Inject a high dose of unc-22 MRNA into worm ovaries, which will be taken up by germ line cells and expressed in progeny O E. Culture worms with E. coli transformed with a plasmid that codes for a dsRNA unc-22 constructarrow_forwardMammals are anatomically and physiologically more complex than roundworms, yet both organisms have approximately the same number of genes, about 20,000. Some biologists have argued that mammals and other vertebrates have evolved increased complexity by means of pleiotropy, and that pleiotropy was made possible largely by the evolution of additional enhancers. Propose an explanation for how additional enhancers might produce increased pleiotropy. Can you find examples of this phenomenon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY