![Campbell Biology In Focus](https://www.bartleby.com/isbn_cover_images/9780134203072/9780134203072_largeCoverImage.jpg)
Campbell Biology In Focus
2nd Edition
ISBN: 9780134203072
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15.3, Problem 1CC
WHAT IF? Suppose the mRNA being degraded in Figure 15.13 coded for a protein that promotes cell division in a multicellular organism. What would happen if a mutation disabled the gene for the miRNA that triggers this degradation?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Q14: The figure below shows a ribosome in the process of translating an mRNA with the sequence:
5'..AUGCCGUAUGCUCUUUA...3'
Elongation
3
5
3
3
LAUGEEGUAUGCU
UACGGC
CG AUGC EUT
P sitez
UAC
A site
A
Met
Pro
Pro
Met
Anticodon
Met
Amino
Incoming-
tRNA
terminus
Pro
© 2001 Sinauer Associates, Inc.
The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’.
The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence
( label 5' and 3’)? Keep in mind the wobble pairing rules and make sure your answer is
consistent with the genetic code. Explain your answer.
а.
b. Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost
all of its alanine tRNAs. Using the figure above as a guide, draw and label the state
the ribosome would arrest in.
Hey, I need help with this:
Describe the main events that occur after transcription to generate a mature mRNA and ensure its correct localisation in the cell. Please include splicing, 5' and 3' modifications, RNA export from the nucleus, and how some mRNAs are localised within the cytoplasm.
Please be very detailed and long explanation ,and dont copy from google answer in your own words
asap please
Q34. mRNA decay (breakdown) can play an important role in controlling protein abundance.
Which of the following scenarios correctly describes a relationship between mRNA decay and protein abundance?
A. A decrease in transcription with an increase in the rate of mRNA decay can result in increased protein abundance.
B. An increase in transcription with an increase in the rate of mRNA decay can result in no change in protein abundance.
C. An increase rate of protein synthesis but failure to form an apoprotein can be explained by a decrease in mRNA decay.
D. None of the above
Chapter 15 Solutions
Campbell Biology In Focus
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Describe the role of complementary base pairing...Ch. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Jellyfish Lake, located on the Pacific island of Palau, is home to millions of jellyfish. Many years ago, sea l...
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Describe the evolution of mammals, tracing their synapsid lineage from early amniote ancestors to true mammals....
LooseLeaf for Integrated Principles of Zoology
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Q1: How many codons code for isoleucine? For tryptophan? For leucine? Q2: What codons are associated with asparagine? With serine? Q3: From the partial mRNA sequence that you specified in Figure 10.6’s question 3 as being transcribed from the DNA template strand, remove only the first A. What amino acid sequence would be translated as a result of this change? How does that sequence compare to the amino acid sequence you translated from the original mRNA sequence?arrow_forwardDate: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.arrow_forwardE22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |arrow_forward
- Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?arrow_forwardE27. A cloned gene fragment contains a regulatory element that is recog- nized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional acti- vation by this transcription factor. To study this effect, you conduct a electrophoretic mobility shift assay and obtain the following results: Tube: 1 2 3 Transcription factor: Hormone: Explain the action of the hormone.arrow_forwardE32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||arrow_forward
- A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.arrow_forward. One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairingwith the ribosome binding site on the sense mRNA toblock translation. In a second, alternative mechanism,the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing thesense promoter for the same gene. Design an experimental approach that would enable you to distinguishbetween these two modes of action at a specific gene.(Hint: What would be the outcome in each case ifhigh levels of the antisense RNA were transcribedfrom a gene on a plasmid?)arrow_forward-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)arrow_forward
- Order+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.arrow_forwardQ11. Ribosomes are “ribonucleoprotein particles” in that they are composed mostly of rRNA with some associated ribosomal proteins. How are the genes coding for ribosomal RNAs the same as the genes coding for ribosomal proteins? They both have a transcriptional start site. They both have similar open reading frames to facilitate binding. They both have a transcriptional terminator. They both suffer frameshift mutations with the insertion of 2 nucleotides. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardList and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY