![Prescott's Microbiology](https://www.bartleby.com/isbn_cover_images/9781260409062/9781260409062_largeCoverImage.gif)
Prescott's Microbiology
11th Edition
ISBN: 9781260409062
Author: WILLEY, Joanne
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15.4, Problem 2CC
Summary Introduction
The messenger RNA (mRNA) is translated into proteins during the translation mechanism in eukaryotes. This process occurs in four stages: initiation, elongation, termination and recycling. Translation occurs on the ribosomes in the cytoplasm of the cell. A polypeptide chain is produced.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Give typed full explanation
Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’
Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density
gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
Viral main protease
what amino acid recognition sequence that is cleaved by viral main protease? where does this protease cut?
Chapter 15 Solutions
Prescott's Microbiology
Ch. 15.2 - Prob. 1CCCh. 15.2 - Prob. 2CCCh. 15.2 - Prob. 3CCCh. 15.2 - Prob. 4CCCh. 15.2 - Prob. 5CCCh. 15.3 - What functions are served by the 5 cap and the 3...Ch. 15.3 - Retrieve, Infer, Apply What elements in archaeal...Ch. 15.3 - Prob. 2CCCh. 15.3 - Prob. 3CCCh. 15.4 - Prob. 1CC
Ch. 15.4 - Prob. 2CCCh. 15.4 - Prob. 3CCCh. 15.5 - Retrieve, Infer, Apply List two similarities and...Ch. 15.5 - Prob. 2CCCh. 15.5 - Retrieve, Infer, Apply How are cis-encoded RNAs,...Ch. 15 - Prob. 1RCCh. 15 - Prob. 2RCCh. 15 - Prob. 3RCCh. 15 - Prob. 4RCCh. 15 - Prob. 5RCCh. 15 - Prob. 6RCCh. 15 - Prob. 7RCCh. 15 - Prob. 8RCCh. 15 - Prob. 9RCCh. 15 - Prob. 1ALCh. 15 - All of the subunits in bacterial RNA polymerases...Ch. 15 - Would you expect that one day microbiologists...Ch. 15 - In the chapter opening story, it was stated that...Ch. 15 - Prob. 5AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is EcoRI? How does EcoRI differ from an exonuclease?arrow_forwardSuppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a team member in the project, you have been asked to provide the following information with high accuracy? I. Chromosome number: II. Protein size: III. Number of exons: IV. Stop codon: V. Size of the longest exon in nucleotidesarrow_forwarddetermine the cytokine the sequence template what is cytokine accession number at GenBank ?arrow_forward
- Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples? B.)aminoacyl tRNA synthetase is specialized or not ? And why?arrow_forwardDesign an oligonucleotide-based affi nity chromatography system for purifying mature mRNAs from eukaryotic cell lysates.arrow_forwardExplain the Combinatorial strategies at the RNA level?arrow_forward
- What is the purpose of hydrolyzing the RNA before conducting biochemical tests?arrow_forwardWhy is yeast RNA insoluble in cold water, ethanol and HCl? And why yeast RNA soluble in hot water and ethanol?arrow_forwardDescribe in detail the process of RNAI including the major protein involved. What is the role of RISC versus RITS? How is siRNA used in biotechnology? What are some limitations of RNAI?arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardSequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA *edited sequence: 1) according to BLAST what is the probable identity of this sequence? 2) what organism does the sequence probably come from genus and species? 3) what is the E value for this sequence ? 4) what is the accession number for this sequenarrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY