Prescott's Microbiology
11th Edition
ISBN: 9781260409062
Author: WILLEY, Joanne
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 15.4, Problem 3CC
Summary Introduction
Transcription and the translation are coupled in prokaryotic cells. The translation process starts when the mRNA is still being synthesized. The translation in eukaryotic organisms begins in a unique way, but proceeds similar to that occurs in bacteria. The messenger RNA (mRNA) is translated into proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Explain the two-dimensional gel electrophoresis (2DGE) ?
Bacterial Identification Virtual Lab
Add the Master Mix and answer the following questions:
13. What does the Master Mix contain?
14. What are primers? Why is a primer added?
15. Once the primers bind, what occurs next?
16. What does "highly conserved" mean?
17. Why are highly conserved regions important in this lab?
in isolating ribosomes from a yield sample, describe the ideal type of centrifugation for this separation technique based on the following:*Type of Centrifugation* Type of fraction *Give 2 advantages of using this type of centrifuge.*Give 2 disadvantages of using this type of centrifuge.
Chapter 15 Solutions
Prescott's Microbiology
Ch. 15.2 - Prob. 1CCCh. 15.2 - Prob. 2CCCh. 15.2 - Prob. 3CCCh. 15.2 - Prob. 4CCCh. 15.2 - Prob. 5CCCh. 15.3 - What functions are served by the 5 cap and the 3...Ch. 15.3 - Retrieve, Infer, Apply What elements in archaeal...Ch. 15.3 - Prob. 2CCCh. 15.3 - Prob. 3CCCh. 15.4 - Prob. 1CC
Ch. 15.4 - Prob. 2CCCh. 15.4 - Prob. 3CCCh. 15.5 - Retrieve, Infer, Apply List two similarities and...Ch. 15.5 - Prob. 2CCCh. 15.5 - Retrieve, Infer, Apply How are cis-encoded RNAs,...Ch. 15 - Prob. 1RCCh. 15 - Prob. 2RCCh. 15 - Prob. 3RCCh. 15 - Prob. 4RCCh. 15 - Prob. 5RCCh. 15 - Prob. 6RCCh. 15 - Prob. 7RCCh. 15 - Prob. 8RCCh. 15 - Prob. 9RCCh. 15 - Prob. 1ALCh. 15 - All of the subunits in bacterial RNA polymerases...Ch. 15 - Would you expect that one day microbiologists...Ch. 15 - In the chapter opening story, it was stated that...Ch. 15 - Prob. 5AL
Knowledge Booster
Similar questions
- Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forwardCan two-dimensional gel electrophoresis be used as a purificationtechnique? Explain.arrow_forwardDiscuss the underlying biochemical principle of the nucleic acid sequencing methods known as Semiconductor (Ion Torrent) sequencing.arrow_forward
- Discuss the disadvantages and advantages of both 2D-DIGE and 2D-PAGE.arrow_forwardTranslation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic perspective, why is this advantageous?arrow_forwardQUESTION: what difficulty will you experience if you do genetic manipulation to streptomyces spp. and how can this difficulty overcome ?? how could you modulate the gene expression for improving the productivity of an antibiotic produced by the streptomyces strain ? discuss with diagramarrow_forward
- Expand PCR? Describe the different Steps involved in this technique?arrow_forwardSequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA *edited sequence: 1) according to BLAST what is the probable identity of this sequence? 2) what organism does the sequence probably come from genus and species? 3) what is the E value for this sequence ? 4) what is the accession number for this sequenarrow_forwardExplain the origin of the signal that is used in the nucleic acid sequencing method known as semiconductor sequencing from Ion Torrent.arrow_forward
- "Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?arrow_forwardElaborate on three (3) lysis methods used to disrupt bacterial cells. During DNA isolation using P: C: I technique, a precipitation step is required. What is the purpose of this step? How can sodium acetate and ethanol facilitate the precipitation step in DNA isolation?arrow_forwardWhy did the researchers discover enrichment for ARGs that confer resistance to antibiotics that were not used at the sites tested? prephase and find answer in articlearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning