CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
12th Edition
ISBN: 9780136486787
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 10TYU
EVOLUTION CONNECTION Some bacteria may be able to respond to environmental stress by increasjng the rate at which mutations occur during cell division. How might this be accomplished? Might there be an evolutionary advantage to this ability? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?
Proteins like channels embedded within the cell's plasma membrane and enzymes scattered in the cytoplasm carry out vital functions. Can you explain the steps of the biological process, allowing cells to make proteins from genes? Can you please provide as many details to each step?
In the:
Mutation of the template gene such that an ACC was converted to ATC.
Explain: (a) What is the process affected?
(b) What is the Effect on the process?
(c) Does it affect prokaryotes, eukaryotes or both?
Chapter 16 Solutions
CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - Prob. 2CCCh. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Prob. 16.3CRCh. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Describe Mendels conclusions about how traits are passed from generation to generation.
Concepts of Genetics (12th Edition)
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
MARINE BIOLOGY
The term ‘spore’.
Biology Science Notebook
The pedigrees indicated here were obtained with three unrelated families whose members express the same disease...
Genetics: From Genes to Genomes
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can you please do questions 20,21 and 22arrow_forwardYou have isolated a strain of mutant yeast cells that divide normally at 25 degrees Celsius but cannot ente4 M phase at 37 degrees Celsius. You found that the gene for M cdk is not mutated. Which of the following temperatures sensitive mutations could be responsible for the.behavior of this strain of yeast? Inactivated of an enzyme that normally degrades m cyclin; Inactivated of a protein that normally triggers the synthesis of m cyclin; Inactivated of a protein kinase that normally Inactivate the cdk; none 2. Which of the following statements about the anaphase promoting complex is false? It promotes the degradation of proteins that activates mitosis; it inhibits m cdk activities; it becomes active at the very beginning of metaphase; it is activated by m cdk 3. During cancer development:.? Cells accumulate mutations in a fixed order which results in increase rate of cell division; the inheritance of mutations caused by dna damage is essential for cancer progression; there is typically…arrow_forwardE 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWERarrow_forward
- i need help finding the specfic location for all of thesearrow_forwardMutations in genes that change their pattern of expression (the time and cell type in which the gene productis produced) are thought to be a major factor in the evolution of different organisms. Would you expect thesame protein to work in the same way (for example, toperform the same kind of enzymatic reaction) in twodifferent types of cells (for example, cells in the retinaof the eye and muscle cells)? Is it possible that the sameprotein might function in different biochemical pathways in eye cells and muscle cells even if the protein’sbasic mechanism always remains the same?arrow_forwardMicrotubules in an animal cell: O a. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicinearrow_forward
- The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…arrow_forward. You receive four strains of yeast in the mail, and theaccompanying instructions state that each strain contains a single copy of transgene A. You grow the fourstrains and determine that only three strains expressthe protein product of transgene A. Further analysisreveals that transgene A is located at a different position in the yeast genome in each of the four strains.Provide a hypothesis to explain this resultarrow_forwardIn the presence of cephalosphorin, what will be the protein product of the prokaryotic cell gene shown below? 5'-CATGTCAGTAAGGCATCT-3' (Assume this is a segment of a larger structural gene that will be translated into protein in its entirety.)arrow_forward
- Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?arrow_forwardGIVE REASON ALSOarrow_forward51. In conjugation, the F+ cell ................................ Group of answer choices serves as a recipient makes competence factors can transfer DNA to other F+ cells contains information for sex pili don't have conjugation pili 52. Bacterial cells when placed in an hypertonic environment ( more solute outside cells compared to inside ) Group of answer choices initiates sporulation process neither of the above happens undergo plasmolysis undergo osmotic lysis germination occursarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License