CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
12th Edition
ISBN: 9780136486787
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16, Problem 13TYU
Summary Introduction
To discuss: How the TAL protein’s structure suggests its functions on the basis of its interaction with DNA.
Concept introduction:
TAL proteins are found in Xanthomonas bacterium. It stands for transcription activator–like (TAL) effector proteins. These are secreted when the bacteria infect certain plant species such as rice, citrus fruits, cotton, and tomatoes. TAL effector proteins contain DNA-binding region through which they enter the plant nucleus and activate transcription leading to infection in the plant.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Correct!
You perform a Sanger sequencing reaction. The template strand is:
5' ATCGAAC 3'
However, you make a mistake and forget to add any dGTP. What is the most likely
outcome?
You will get a single band representing a 1-nucleotide product in the G lane.
You will get no bands in the G lane.
You will get a single band representing a 7-nucleotide product in the G lane.
You will get a single band representing a 3-nucleotide product in the G lane.
You will get two bands representing 1- and 5-nucleotide products in the G lane.
Below is a sequence of DNA.
5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3'
Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)?
Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
DNA
5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand
3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand
Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be
produced based on the information in the DNA fragment above (start with 5' and end with 3').
If you separate codons in MRNA with blank spaces, it will be easier to do the next step.
MRNA: 5'
Using a three-letter code for amino acids write the sequence of the first ten amino acids
of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
Chapter 16 Solutions
CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - Prob. 2CCCh. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Prob. 16.3CRCh. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwardDraw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.arrow_forwardBuild a 3D model of a DNA molecule:-3-dimensional built structure -Contain sugar-phosphate backbones (constructed as separate molecules) -Contain nitrogenous bases (paired clearly and correctly) -Have a minimum of 10 base-pairs (minimum of 10 “rungs” or “steps” on the ladder) with the correct number of hydrogen bonds illustrated between each of the base pairs. -Have the orientation labeled on each strand and make sure the two strands are antiparallel.arrow_forward
- Genetic Engineering Process (GEP) # 1: (What kind of process?) Picture A (Sequence #_ DNA introduced into bacterial cells Picture B (Sequence #, DNA ligase added, seals overhangs TTAA AATT AAT AATT TAA TTA TAA PATT PATT AATT recombinant DNA molecules Picture C (Sequence #. donor DNA vector vector and donor DNA digested (cleaved) with restriction enzyme AATT AATT 1477 AATT TTAA overhangs TTAA 1477 Picture D (Sequence #. AATT mixing recombinant DNA molecules replicate and cells dividearrow_forwardQuantification of DNA can be done by using a Nanodrop, a UV spectrophotometer, by measuring its absorbance in units of optical density (OD) (see “Nanodrop Microvolume Quantitation of Nucleic Acids" video in Lab 3 on Laulima). DNA absorbs light most strongly at the ultraviolet wavelength of 260 nm. The absorbance of double stranded DNA (dsDNA) at 260 nm (A260) is used to estimate concentration, with 1.0 OD equal to a dsDNA concentration of 50 µg/ml. Using this information we can calculate the concentration of dsDNA in our extractions using the following formula: dsDNA concentration = 50 µg/ml x OD260 x dilution factor Using the formula provided above, calculate the concentration of dsDNA in an extraction that was diluted 20X and had an A260 reading of 0.64 OD. Show your workarrow_forwardCynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X Garrow_forward
- What is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? Please select the single answer that is most correct GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of A the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in C the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in D the agarose gel.arrow_forward5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answerarrow_forwardNo drawings just writing the answer a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:arrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).arrow_forwardCorrect order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forward5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY