CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
CAMPBELL BIOLOGY-MASTERING BIO.ACCESS
12th Edition
ISBN: 9780136486787
Author: Urry
Publisher: SAVVAS L
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 16, Problem 13TYU
Summary Introduction

To discuss: How the TAL protein’s structure suggests its functions on the basis of its interaction with DNA.

Concept introduction:

TAL proteins are found in Xanthomonas bacterium. It stands for transcription activator–like (TAL) effector proteins. These are secreted when the bacteria infect certain plant species such as rice, citrus fruits, cotton, and tomatoes. TAL effector proteins contain DNA-binding region through which they enter the plant nucleus and activate transcription leading to infection in the plant.

Blurred answer
Students have asked these similar questions
Correct! You perform a Sanger sequencing reaction. The template strand is: 5' ATCGAAC 3' However, you make a mistake and forget to add any dGTP. What is the most likely outcome? You will get a single band representing a 1-nucleotide product in the G lane. You will get no bands in the G lane. You will get a single band representing a 7-nucleotide product in the G lane. You will get a single band representing a 3-nucleotide product in the G lane. You will get two bands representing 1- and 5-nucleotide products in the G lane.
Below is a sequence of DNA.   5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)?    Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
DNA 5' ATGGCTTCTCAATACTGCTTTGTTTTGGTT 3' template strand 3' TACCGAAGAGTTATGACGAAACAAAACCAA 5' coding strand Write down the sequence of nucleotides in a fragment of an m-RNA molecule that will be produced based on the information in the DNA fragment above (start with 5' and end with 3'). If you separate codons in MRNA with blank spaces, it will be easier to do the next step. MRNA: 5' Using a three-letter code for amino acids write the sequence of the first ten amino acids of the protein pectate lyase (refer to the table of 64 codons from a lecture or a textbook).
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY