To analyze:
Access to http://blast.ncbi.nlm.nih.gov/Blast.cgi and type in the sequence below in the link
Collect the information on the basis of steps mentioned in the question and determine the DNA sequence.
Introduction:
In bioinformatics, BLAST stands for “basic local alignment search tool” that finds the region of local similarity between the biological sequences. This algorithm compares a DNA sequence or an amino acid sequence to the sequences that are in the databases and calculates the statistical significance of the sequence matches. BLAST can be used to identify the members that belong to one gene family. There are different types of BLAST present used according to the query sequence.
Want to see the full answer?
Check out a sample textbook solutionChapter 16 Solutions
Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forwardFor each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.arrow_forwardThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Glyarrow_forward
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGarrow_forwardWhat is the DNA template of the following DNA coding: ATGGCTAACCTTGTAarrow_forwardYou have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forward
- please answer the highlighted questionarrow_forwardDecode the hidden message. Translate the mRNA into amino acids. Use only the letter for the amino acid.arrow_forwardThe X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acidsarrow_forward
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGarrow_forwardWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAarrow_forwardGiven below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education