bartleby

Videos

Textbook Question
Book Icon
Chapter 16, Problem 17P

You have isolated a gene that is important for the production of milk and wish to examine its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.

How would you identify the regulatory elements important for the expression of your isolated gene in mammary glands?

What does the existence of orthologous genes in chicken and pufferfish tell you about the function of this gene?

Blurred answer
Students have asked these similar questions
In a particular organism, there are two similar genes called YFG1 and YFG2. YFG1 is expressed in the liver and not in the pancreas, and YFG2 is expressed in the pancreas but not the liver. Neither YFG1 nor YFG2 is expressed in the heart. If you extract DNA from heart cells, do you expect to see the YFG2 gene? Explain why. Do you expect to see the YFG1 protein when you analyze protein extract from liver cells? And from pancreas cells? And from heart cells? Explain why. Is it possible to produce YFG1 and YFG2 proteins via alternative splicing? Explain one possible way (mechanism) to regulate the expression of YFG1 gene.
Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes? A. Nanos mRNA injected into the anterior end of an oocyte B. Antp protein injected into the posterior end of an embryo C. Toll mRNA injected into the dorsal side of an early embryo
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.   You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?               You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?     5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’         After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…

Chapter 16 Solutions

Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License