Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 16, Problem 17P
You have isolated a gene that is important for the production of milk and wish to examine its regulation. You examine the genomes of human, mouse, dog, chicken, pufferfish, and yeast and note that all genomes except yeast have an orthologous gene.
How would you identify the regulatory elements important for the expression of your isolated gene in mammary glands?
What does the existence of orthologous genes in chicken and pufferfish tell you about the function of this gene?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a particular organism, there are two similar genes called YFG1 and YFG2. YFG1 is expressed in the liver and not in the pancreas, and YFG2 is expressed in the pancreas but not the liver. Neither YFG1 nor YFG2 is expressed in the heart. If you extract DNA from heart cells, do you expect to see the YFG2 gene? Explain why. Do you expect to see the YFG1 protein when you analyze protein extract from liver cells? And from pancreas cells? And from heart cells? Explain why. Is it possible to produce YFG1 and YFG2 proteins via alternative splicing? Explain one possible way (mechanism) to regulate the expression of YFG1 gene.
Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subsequent development of the embryo, larva, and adult. For example, if Bicoid protein is injected into the posterior region of an oocyte, the resulting embryo will develop into a larva that has anterior structures at both ends. Based on your understanding of the function of each developmental gene, what would be the predicted phenotype if the following proteins or mRNAs were injected into normal oocytes?
A. Nanos mRNA injected into the anterior end of an oocyte
B. Antp protein injected into the posterior end of an embryo
C. Toll mRNA injected into the dorsal side of an early embryo
You are interested in the effects of mutations on the expression of a human protein-
encoding gene expressed in skin cells. The gene has one intron that is 450
nucleotides long. After this intron is removed from the pre-mRNA, the mRNA
transcript is 1100 nucleotides in length. Diploid somatic cells have two copies of this
gene. Predict the size and amount of mRNA from the cytosol of skin cells, which
were obtained from the following individuals:
• Individual 1: Normal individual with no mutations in this gene.
• Individual 2: Homozygous for a deletion that removes the -10 to -100 region of
the gene that encodes this mRNA.
• Individual 3: Heterozygous in which one gene is normal and the other gene has a
deletion that removes the -10 to -100 region.
• Individual 4: Homozygous for a five-nucleotide deletion in the intron that
removes the GT sequence at the 5' splice site.
Explain your answers.
Chapter 16 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 16 - You have discovered a new species of Archaea from...Ch. 16 - 16.2 Repetitive DNA poses problems for genome...Ch. 16 - 16.3 When the whole-genome shotgun sequence of the...Ch. 16 - How do cDNA sequences facilitate gene annotation?...Ch. 16 - 16.5 How do comparisons between genomes of related...Ch. 16 - 16.6 You are designing algorithms for the...Ch. 16 - 16.7 You have sequenced a region of the Bacillus...Ch. 16 - You have just obtained 100-kb of genomic sequence...Ch. 16 - 16.9 The human genome contains a large number of...Ch. 16 - Based on the tree of life in Figure 16.12, would...
Ch. 16 - 16.11 When comparing genes from two sequenced...Ch. 16 - 16.12 What is a reference genome? How can it be...Ch. 16 - Prob. 13PCh. 16 - Prob. 14PCh. 16 - 16.16 Consider the phylogenetic tree below with...Ch. 16 - You have isolated a gene that is important for the...Ch. 16 - 16.18 When the human genome is examined, the...Ch. 16 - Symbiodinium minutum is a dinoflagellate with a...Ch. 16 - Substantial fractions of the genomes of many...Ch. 16 - 16.21 A modification of the system, called the ...Ch. 16 - 16.22 A substantial fraction of almost every...Ch. 16 - 16.23 In the globin gene family shown in Figure ,...Ch. 16 - You are studying similarities and differences in...Ch. 16 - In conducting the study described in Problem 24,...Ch. 16 - Prob. 26PCh. 16 - Prob. 27PCh. 16 - Prob. 28PCh. 16 - Prob. 29P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardThe transcription factor Pax6 is required continually during the life of a mouse (or a human) for the development of the retina. Homozygous Pax6 knockout mice die soon after birth because Pax6 protein is also required in essential organs, such as the pancreas. a) In order to study the role of Pax6 in eye development a researcher wants to generate a mouse that expresses Pax6 everywhere except in its eyes. Describe how you could construct such a mouse by floxing the gene. Is it possible to achieve the same end with a transgene? (Hint: think about using cDNA and RNAI) b) Suppose you want to create a mouse similar to that in part (a), but one where the eye cells from Pax6 function has been removed and now express a gene that specifies a green fluorescent protein (GFP). Marking the cells in this way will allow the investigators to see the shapes of the Pax6- eye cells more easily than if they did not express GFP. Diagram a Pax6 gene construct that would enable the researcher to do this…arrow_forwardOur understanding of maternal effect genes has been greatly aided by their identification in experimental organisms such as Drosophila melanogaster and Caenorhabditis elegans. In experimental organisms with a short generation time, geneticists have successfully searched for mutant alleles that prevent the normal process of embryonic development. In many cases, the offspring die at early embryonic or larval stages. These are called maternal effect lethal alleles. How would a researcher identify a mutation that produced a recessive maternal effect lethal allele?arrow_forward
- You are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?arrow_forwardThe GAL4 expression system can be used to experimentally induce expression of a gene in a specific tissue at a specific time. You want to study the overexpression of Your Favorite Gene (YFG) in mouse ear development. However, if you overexpress this gene everywhere, the mouse is not viable past early embryo development. You have the following mouse lines with different mutations or transgenic constructs available. Which two will you cross together to answer your research questions? GAL4 with constitutive enhancer GAL4 with embryo enhancer GAL4 with ear enhancer yfg loss-of-function line YFG CDNA with UASG promoter YFG CDNA with constitutive promoterarrow_forwardHow would you explain gene expression? How is it that a particular genotype is actually expressed as a phenotype? I am looking for details here, including an explanation of the molecular mechanisms involved.arrow_forward
- Progesterone is a steroid hormone (also described as a ligand) that prepares the body for pregnancy. It binds to the progesterone receptor (PR) protein in the cytoplasm of various cells. Ligand bound PR acts as a transcriptional activator, binds to the DNA in the promoter region of several genes and leads to transcriptional activation of these genes. Which of the following statements must be true for the PR protein? O Ligand binding to the PR results in a conformational change in the primary structure of the protein The domain/region of the PR protein that interacts with the DNA, has basic amino acids Ligand binding to the PR results in a conformational change in the tertiary structure of the protein The domain/region of the PR protein that interacts with the DNA, has acidic amino acidsarrow_forwardMost organisms display a circadian rhythm, a cycling of biological processes that is roughly synchronized with day length. In Drosophila, pupae eclose (emerge as adults after metamorphosis) at dawn. a)Using this knowledge how would screen for Drosophila mutants that have an impaired circadian rhythm? b)In each case, how would you clone the genes you identified by mutation?arrow_forwardThe phenotype of a heterozygous mouse (Aa) is agouti. The agouti banding pattern is due to altered expression of the agouti gene. Which of the following statement is false? a) Expression of the agouti gene inhibits the production of eumelanin. b) Evidence suggests that the agouti gene is only expressed in tissues associated with fur production. c) Epigenetic markers silence the agouti gene resulting in dark pigmentation at the tip and root of the hair. d) All of the abovearrow_forward
- As we have learned in this chapter, the Nanos protein inhibits the translation of hunchback mRNA, lowering the concentration of Hunchback protein at the posterior end of a fruit-fly embryo and stimulating the differentiation of posterior characteristics. The results of experiments have demonstrated that the action of Nanos on hunchback mRNA depends on the presence of an 11-base sequence that is located in the 3′ untranslated region (3′ UTR) of hunchback mRNA. This sequence has been termed the Nanos response element (NRE). There are two copies of NRE in the 3′ UTR of hunchback mRNA. If a copy of NRE is added to the 3′ UTR of another mRNA produced by a different gene, that mRNA is repressed by Nanos. The repression is greater if several NREs are added. On the basis of these observations, propose a mechanism for how Nanos inhibits Hunchback translation.arrow_forwardIn a mutant mouse, it was discovered that a gene "W" is moved from its original chromosomal locus to the telomere region, where chromatin is packed into heterochromatin. Given what we have learned about eukaryotic gene regulation, can you speculate how the expression of gene W in the new mouse line would be changed as compare to the normal mouse? Question 18 options: elevated in the mutant mouse than in the wild-type mouse. cannot be determined. reduced in the mutant mouse than in the wild-type mouse. no change in the mutant mouse as compared to the wild-type mouse.arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, a wildtype nucleotide sequence and a polyadenylation sequence. However, the gene does not produce a functional protein. Part A: List up to five reasons why this gene is not expressed in E. coli. Part B: What changes do you recommend that would facilitate expression of the eukaryotic gene in E. coli.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License