Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 7P
You have sequenced a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp.
A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?
You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options.
Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins.
Protein sequences are expected to evolve and…
You have sequenced the genome of the bacterium Salmonella typhimurium and find
a protein that is 100 percent identical to a protein in the bacterium Escherichia coli.
When you compare nucleotide sequences of the S. typhimurium and E. coli genes,
you find that their nucleotide sequences are only 87 percent identical. How would
you interpret the observations? Please make sure to select ALL correct answer
options.
Because genetic code is redundant, changes in the DNA nucleotide sequence
can occur without change to its encoded protein.
Due to the flexibility in the third positions of most codons, the DNA sequence
can accumulate changes without affecting protein structure.
Natural selection will eliminate many deleterious amino acid changes. This will
reduce the rate of change in the amino acid sequence and lead to sequence
conservation of the proteins.
Protein sequences are expected to evolve and diverge more slowly than the
genes that encode them.
Chapter 16 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 16 - You have discovered a new species of Archaea from...Ch. 16 - 16.2 Repetitive DNA poses problems for genome...Ch. 16 - 16.3 When the whole-genome shotgun sequence of the...Ch. 16 - How do cDNA sequences facilitate gene annotation?...Ch. 16 - 16.5 How do comparisons between genomes of related...Ch. 16 - 16.6 You are designing algorithms for the...Ch. 16 - 16.7 You have sequenced a region of the Bacillus...Ch. 16 - You have just obtained 100-kb of genomic sequence...Ch. 16 - 16.9 The human genome contains a large number of...Ch. 16 - Based on the tree of life in Figure 16.12, would...
Ch. 16 - 16.11 When comparing genes from two sequenced...Ch. 16 - 16.12 What is a reference genome? How can it be...Ch. 16 - Prob. 13PCh. 16 - Prob. 14PCh. 16 - 16.16 Consider the phylogenetic tree below with...Ch. 16 - You have isolated a gene that is important for the...Ch. 16 - 16.18 When the human genome is examined, the...Ch. 16 - Symbiodinium minutum is a dinoflagellate with a...Ch. 16 - Substantial fractions of the genomes of many...Ch. 16 - 16.21 A modification of the system, called the ...Ch. 16 - 16.22 A substantial fraction of almost every...Ch. 16 - 16.23 In the globin gene family shown in Figure ,...Ch. 16 - You are studying similarities and differences in...Ch. 16 - In conducting the study described in Problem 24,...Ch. 16 - Prob. 26PCh. 16 - Prob. 27PCh. 16 - Prob. 28PCh. 16 - Prob. 29P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportionsarrow_forwardDraw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).arrow_forwardIf you had the RNA sequence below: 5'UUUGGAG 3' and you were going to make a piece of DNA that would be a complement to it, what would the DNA sequence be? 5' 3' What 12-nucleotide primer would you use in the PCR technique when you want to amplify a gene whose end is as follows: 3' CGGCTCGACAAGGTG5' ? 5' 3'arrow_forward
- Nucleosomes can be assembled onto defined DNA segments. When a particular 225-bp segment of human DNA was used to assemble nucleosomes and then incubated with micrococcal nuclease, which digests DNA that is not located within the nucleosome, uniform fragments 147 bp in length were generated. Subsequent digestion of these fragments with a restriction enzyme that cuts once within the original 225-bp sequence produced two well-defined bands at 37 bp and 110 bp. Why do you suppose two well-defined fragments were generated by restriction digestion, rather than a range of fragments of different sizes? How would you interpret this result?arrow_forwardIn the practical you have been analysing a human genomic library. You know from your calculations that only a small proportion of the human genome is represented, even when the entire class results are considered. Therefore, the chance of finding a particular single-copy gene in your library is very small. Outline a strategy for constructing a genomic DNA library more representative of the entire human genome. You will need to consider alternative vectors and the efficiency of transformation of the bacterial cells.arrow_forwardIn order to target a specific region of genomic DNA with CRISPR, researchers must include a guide RNA containing a 20-basepair long spacer sequence that matches the DNA sequence at the target site. (i) How many possible guide RNA spacer sequences are there? (ii) One of the possible risks of genetic engineering methods is “off-target” editing, where a modification of the genome occurs in a part of the genome other than the target site. Imagine you design a 20-basepair guide RNA spacer sequence to target a specific portion of the Zebrafish genome, which is 1.7 billion nucleotides long. Assuming all nucleotides are equally common, estimate the probability that your spacer sequence occurs in at least one other position in the Zebrafish genome.arrow_forward
- You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…arrow_forwardAbout 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base pairs of DNA, about how many times will the following restriction sites be present? a. BamHI (recognition sequence is 5′–GGATCC–3′) b. EcoRI (recognition sequence is 5′–GAATTC–3′) c. HaeIII (recognition sequence is 5′–GGCC–3′)arrow_forwardThe image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forward
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardYou are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.arrow_forwardSome synthetic biologists have proposed creating an entirely new, freeliving organism with a minimal genome, the smallest set of genes that allows for replication of the organism in a particular environment. This genome could be used to design and create, from “scratch,” novel organisms that might perform specific tasks, such as the breakdown of toxic materials in the environment. Q. How might the minimal genome required for life be determined?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license