The reason for the failure of a transcriptionally active fusion gene to cause chronic myelogenous leukemia (CML) in healthy individuals. Introduction: Chronic myelogenous leukemia is a type of cancer of the white blood cells (WBCs). In this form of leukemia, an increased and unregulated growth of the immature myeloid cells occurs in the bone marrow. This is followed by the accumulation of these proliferated cells in the blood and spleen. The characteristic genetic change responsible for this disease is a chromosomal translocation that leads to the formation of Philadelphia chromosome that contains the Breakpoint cluster region (BCR) and Abelson murine leukemia (ABL) genes to form a fusion protein, this protein is responsible for the failure of cell cycle control.

Question

Want to see the full answer?

Answer 1

Question

Chapter 16, Problem 26PDQ

Summary Introduction

To review:

The reason for the failure of a transcriptionally active fusion gene to cause chronic myelogenous leukemia (CML) in healthy individuals.

Introduction:

Chronic myelogenous leukemia is a type of cancer of the white blood cells (WBCs). In this form of leukemia, an increased and unregulated growth of the immature myeloid cells occurs in the bone marrow. This is followed by the accumulation of these proliferated cells in the blood and spleen. The characteristic genetic change responsible for this disease is a chromosomal translocation that leads to the formation of Philadelphia chromosome that contains the Breakpoint cluster region (BCR) and Abelson murine leukemia (ABL) genes to form a fusion protein, this protein is responsible for the failure of cell cycle control.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA

Mutational signatures of p53 are shown in this image (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000). These data can be obtained by sequencing the gene that encodes p53. Approximately 85 percent of lung cancers occur in smokers. Based on these data, calculate how many deaths due to lung cancer among nonsmokers were reported in 2016. How much does smoking increase the likelihood of death due to lung cancer?

Below is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…