ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16, Problem 39P
Summary Introduction
To determine:
The process by which the small RNA species identified by cDNA sequencing is considered as regulatory sRNAs, but not fragments of longer mRNA.
Introduction:
The regulatory sRNAs (small ribonucleic acid) are identified by transcriptome sequencing (RNA-seq). sRNAs are usually heterogeneous in their secondary sequence and sequence length as compared to the fragment of longer messenger RNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Once a primary RNA transcript is created from a DNA template, it must be modified in
several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or
transfer RNA (TRNA). The following image shows RNA processing of one pre-mRNA
into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap
(G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from
the pre-mRNA transcript. Please redraw the following diagram and label the following
on your diagram:
DNA
Promoter
pre-mRNA
(unprocessed)
mRNA
*5' methylguanylate cap
*polyadenylation
*Exon (may be more than one)
*Intron (may be more than one)
Transcription
RNA processing
AAAAA
PART C: FOLLOW-UP QUESTIONS
1. Why is a poly-A tail important?:
2. What do introns do? Why do they exist in eukaryotes when they are mostly
absent in prokaryotes?
3. What do you think 'alternative splicing' means, and how might it expand the
function of a gene?
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C.
a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C.
b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
Chapter 16 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - The following statement occurs early in this...Ch. 16 - One of the main lessons of this chapter is that...Ch. 16 - All mutations that abolish function of the Rho...Ch. 16 - The figure at the beginning of this chapter shows...Ch. 16 - The promoter of an operon is the site to which RNA...Ch. 16 - You are studying an operon containing three genes...Ch. 16 - You have isolated a protein that binds to DNA in...Ch. 16 - You have isolated two different mutants reg1 and...Ch. 16 - Bacteriophage , after infecting a cell, can...
Ch. 16 - Mutants were isolated in which the constitutive...Ch. 16 - Suppose you have six strains of E. coli. One is...Ch. 16 - The previous problem raises some interesting...Ch. 16 - For each of the E. coli strains containing the lac...Ch. 16 - For each of the following growth conditions, what...Ch. 16 - For each of the following mutant E. coli strains,...Ch. 16 - Maltose utilization in E. coli requires the...Ch. 16 - Seven E. coli mutants were isolated. The activity...Ch. 16 - Cells containing missense mutations in the crp...Ch. 16 - Six strains of E.coli mutants 16 that had one of...Ch. 16 - a. The original constitutive operator mutations in...Ch. 16 - In an effort to determine the location of an...Ch. 16 - Prob. 23PCh. 16 - The footprinting experiment described in Fig....Ch. 16 - Why is the trp attenuation mechanism unique to...Ch. 16 - a. How many ribosomes are required at a minimum...Ch. 16 - The following is a sequence of the leader region...Ch. 16 - For each of the E. coli strains that follow,...Ch. 16 - Prob. 29PCh. 16 - For each element in the list that follows,...Ch. 16 - Among the structurally simplest riboswitches are...Ch. 16 - Great variation exists in the mechanisms by which...Ch. 16 - Many genes whose expression is turned on by DNA...Ch. 16 - In 2005, Frederick Blattner and his colleagues...Ch. 16 - The E.coli MalT protein is a positive regulator of...Ch. 16 - Prob. 36PCh. 16 - Prob. 37PCh. 16 - Prob. 38PCh. 16 - Prob. 39PCh. 16 - Prob. 40PCh. 16 - Prob. 41PCh. 16 - The researchers who investigated bioluminescence...Ch. 16 - Prob. 43PCh. 16 - Quorum sensing controls the expression of...Ch. 16 - Scientists are currently screening a chemical...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Once a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAAarrow_forwardConsidering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forwardConsider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing? 5'-AUGCAAGCAUUGGCCAAGCUU-3' 5'-AUGCAAGCAUUGGCCAAGCUU-3 5'-UACGUUCGUAACCGGUUCGAA-3' 5'-AAGCUUGGUUAAUGCUUGCAU-3' 5'-UUCGAACCAAUUACGAACGUA-3' 3'-UUCGAACCAAUUACGAACGUA-5 3'-AUGCAAGCAUUGGCCAAGCUU-5'arrow_forward
- The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardConsider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forward
- Although the genetic code is universal, a few organisms such as Paramecium have a slightly modified version in which UGA, a stop codon for most organisms, codes for tryptophan in Paramecium. Suppose that the researcher wanted to make an in vitro translation system using all of the components from Paramecium. Which of the components, if any, would she need to replace in order to have an in vitro system that was universal? Possible Answers: A. She would need to leave out the P site. B. She would need to leave out the termination factor proteins. C. She would need to leave out the tRNA that recognizes UGA. D. She would need to leave out the ubiquitinarrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardMany uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)arrow_forward
- a) Design an mRNA sequence that would be translated by this system as a polypeptide consisting of alternating His and Thr. b) If you use a natural RNA polymerase extracted from E. coli, what modification you need to do to your synthetic mRNA to produce the polypeptide consisting of alternating His and Thr?arrow_forwardIf an antisense RNA is designed to silence the following mRNA sequence, which of the following antisense oligos (a-d) could be used for this purpose? mRNA sequence: 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' AUCCUGAUAAUUCCAUGUAAAUAA 3' O 5' AAUGGGUGUACCUUAAUAGUCCUA 3' O 5' UAGGACUAUUAAGGUACACCCAUU 3' O 5' UUACCCACAUGGAAUUAUCAGGAU 3¹arrow_forwardWhat is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license