ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 24P
The footprinting experiment described in Fig. 16.16 depended on having a fragment of double-stranded DNA that was labeled with radioactivity at one end of one strand.
a. | How would you make such a labeled fragment of DNA? Outline the steps you would perform, starting with two PCR primers and some genomic DNA. You also have available a kinase enzyme that adds phosphate groups to the 5′ ends of DNA strands, radioactive ATP, and a restriction enzyme of your choice. You could also use a phosphatase enzyme that removes phosphate groups from the 5′ ends of DNA strands. |
b. | Why does the footprinting experiment require a fragment of DNA labeled only on one end of one strand? In other words, how would the results of the experiment differ from those shown in Fig. 16.16 if the DNA was labeled on both strands at their 5′ ends, or if the DNA was labeled with radioactive phosphate along its entire length at every phosphodiester bond? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an organism using the Hindill restriction enzyme. You then take a
plasmid with a single EcoRI restriction site and cleave it with EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions
below.
a. Does the cloning reaction succeed as described? If so, what is the product obtained?
b. Explain your answer above,
In relation to the use of restriction enzymes in recombinant DNA technology, answer the following:
You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img)
i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples?
ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
Chapter 16 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - The following statement occurs early in this...Ch. 16 - One of the main lessons of this chapter is that...Ch. 16 - All mutations that abolish function of the Rho...Ch. 16 - The figure at the beginning of this chapter shows...Ch. 16 - The promoter of an operon is the site to which RNA...Ch. 16 - You are studying an operon containing three genes...Ch. 16 - You have isolated a protein that binds to DNA in...Ch. 16 - You have isolated two different mutants reg1 and...Ch. 16 - Bacteriophage , after infecting a cell, can...
Ch. 16 - Mutants were isolated in which the constitutive...Ch. 16 - Suppose you have six strains of E. coli. One is...Ch. 16 - The previous problem raises some interesting...Ch. 16 - For each of the E. coli strains containing the lac...Ch. 16 - For each of the following growth conditions, what...Ch. 16 - For each of the following mutant E. coli strains,...Ch. 16 - Maltose utilization in E. coli requires the...Ch. 16 - Seven E. coli mutants were isolated. The activity...Ch. 16 - Cells containing missense mutations in the crp...Ch. 16 - Six strains of E.coli mutants 16 that had one of...Ch. 16 - a. The original constitutive operator mutations in...Ch. 16 - In an effort to determine the location of an...Ch. 16 - Prob. 23PCh. 16 - The footprinting experiment described in Fig....Ch. 16 - Why is the trp attenuation mechanism unique to...Ch. 16 - a. How many ribosomes are required at a minimum...Ch. 16 - The following is a sequence of the leader region...Ch. 16 - For each of the E. coli strains that follow,...Ch. 16 - Prob. 29PCh. 16 - For each element in the list that follows,...Ch. 16 - Among the structurally simplest riboswitches are...Ch. 16 - Great variation exists in the mechanisms by which...Ch. 16 - Many genes whose expression is turned on by DNA...Ch. 16 - In 2005, Frederick Blattner and his colleagues...Ch. 16 - The E.coli MalT protein is a positive regulator of...Ch. 16 - Prob. 36PCh. 16 - Prob. 37PCh. 16 - Prob. 38PCh. 16 - Prob. 39PCh. 16 - Prob. 40PCh. 16 - Prob. 41PCh. 16 - The researchers who investigated bioluminescence...Ch. 16 - Prob. 43PCh. 16 - Quorum sensing controls the expression of...Ch. 16 - Scientists are currently screening a chemical...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are performing a PCR reaction but unbeknownst to you, there is a significant pool of dUTP in the nucleotide mix (along with dCTP, dTTP, dATP, and dGTP). How might this affect your PCR product? a. If the PCR product was ligated into a plasmid and put into a cell, a totally different mRNA would be made from the insert compared to an insert made with T's. b. If the pool of dTTP ran out before the pool of dUTP, DNA replication could no longer occur. c. During the reaction, uracils incorporated into the product would cause the PCR product to degrade as it is being made. d. Uracil would be incorporated into the product and would lessen the affinity of any DNA binding proteins that might bind to the product in subsequent experiments. e. Nothing would happen since polymerases can't use dUTP to make DNA.arrow_forwardDescribe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardThe answer is option A In the PCR amplification, two primers are used to flank the target region to amplification. The two primers are forward primer and reverse primer. The forward primer binds to the template DNA and the reverse primer binds to the complementary strand. Step 2 In the above question, the two sequences of 21bp primers in the 5' to 3' Orientation that allows amplifying the given gene sequence are : ATGTTTGTTTTTCTTGTTTTA and GTCAAATTACATTACACATAA CAN YOU FURTHER EXPLAIN WHY IT IS "GTCAAATTACATTACACATAA," I don't understand why it's called reverse primer? and where exactly it is binding to on the strand? (A picture would really help)arrow_forward
- You want to clone a specific PCR amplicon. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map included). After enzyme digestion your amplicon is 854 bp long. What length will the recombinant plasmid be after you have inserted your amplicon? Show a calculation.arrow_forwardYou are tasked with amplifying a gene of interest with PCR. a. After performing a Southern blot, you see no signal on your gel. What could have happened with your PCR? b. After troubleshooting your PCR, you now want to perform Reverse Transcriptase (RT) PCR to look at MRNA expression. Assuming the primers in 2a were not the problem for your DNA and using the same primers as 2a, you see no signal on your Southern blot. What are possible causes?arrow_forwardIn making recombinant DNA molecules that combine restriction fragments from different organisms, researchers usually prefer restriction enzymes like BamHI or HindIII that generate fragments with “sticky ends” (ends with overhangs) rather than enzymes like HpaI or SmaI (Table 12.1) that generate fragments with “blunt ends” (ends without overhangs). Can you think of a reason for this preference?arrow_forward
- You are performing PCR for the first time using some new primers that are 25 nucleotides in length with an estimated melting temperature of 65 0C to amplify a 200 nucleotide gene. After PCR, you run an agarose gel on the samples and observe a faint band at 25 nucleotides. What is the best possible explanation for the results? The primers hybridized to multiple sites on the DNA template. Too much template DNA was added to the PCR mixture. The primers dimerized preventing DNA transcription from occurring. A nuclease was in the solution causing degradation of the DNA.arrow_forwardThe temperature at which the primers and target DNA hybridize may be changed to influence the stringency of PCR amplification. What effect will changing the hybridization temperature have on the amplification? Let's say you have a certain yeast gene A and want to check whether it has a human equivalent. How might managing the hybridization's rigor benefit you?arrow_forwardYou wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.arrow_forward
- A restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis. Use the linear restriction map to predict where bands would be expected on a gel if a digest is performed using the specified restriction enzymes. Assume that there is enough restriction enzyme that every possible restriction site on each molecule of DNA will be cut.arrow_forwardA more modern molecular technique to RFLP fingerprinting is called Amplified Fragment Length Polymorphisms (AFLPs). In AFLP analysis, restriction enzymes are again used to digest genomic DNA into multiple fragments. Next, adapters complementary to restriction site overhangs are ligated to the fragments using an enzyme called DNA ligase. These adapters are complementary to primers used to amplify the fragments using the polymerase chain reaction (PCR). Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.arrow_forwardThe same restriction endonuclease must be used to excise the foreign DNA and bacterial DNA. Select one: True False Why? Select one: a. It must use different restriction endonucleases because the bacterial and foreign DNA sequences are different. b. It must use same restriction endonuclease so that the restriction sites are identical in both foreign and bacterial DNA. c. It must use same restriction endonuclease so that the restriction sites are different in both foreign and bacterial DNA. d. It must use different restriction endonucleases because the bacterial and foreign DNA sequences are exactly the same.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License