MODIFIED MASTER.BIOLOGY-ACCESS >CUSTOM<
16th Edition
ISBN: 9781323279656
Author: Pearson Custom
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.2, Problem 4CC
Summary Introduction
To determine: How the synthesis of the leading strand be affected if DNA pol I was non-functional and also point out the location of function of DNA pol I in the given figure.
Concept introduction:
DNA is a double-stranded molecule. During its replication, the two parent strands unwind, and each strand acts a template for the synthesis of a new strand. DNA polymerase enzyme adds
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Picture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?
VISUAL SKILLS Compare Figure 20.7 with Figure 16.20.How does replication of DNA ends during PCR proceedwithout shortening the fragments each time?
Quick help Only cell biology
Which process is described in the following paragraph?
During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.
Chapter 16 Solutions
MODIFIED MASTER.BIOLOGY-ACCESS >CUSTOM<
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - What two properties, one structural and one...Ch. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Describe the levels of chromatin packing you'd...Ch. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - Prob. 4TYUCh. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - Prob. 11TYUCh. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.arrow_forwardDNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.arrow_forwardExamine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.arrow_forward
- Transcribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCGarrow_forward5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI templatearrow_forwardWhich statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.arrow_forward
- Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forwardHuman Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?arrow_forwardMultiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.arrow_forward
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forward Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase B) Helicase C) DNA Polyerase D) Primase The genetic code A) has no redundancy but does have ambiguity B) has both redundancy and ambiguity C) has redundancy and not ambiguity D) has ambiguity E) has redundancyarrow_forwardTask A: Polymerase Chain Reaction Master Mix Your first task is to isolate and amplify the NRAS gene from cDNA extracted from different samples through PCR. You will need to run a total of 7 PCRs: 3 normal samples, 3 cancerous samples, and 1 negative control. To make things easier in the lab, when running multiple reactions, the components are prepared not individually, but as a master mix—all the components for multiple reactions are prepared in bulk, except for the template DNA, which is added separately once the master mix has been distributed into individual tubes. The table below lists the different components for PCR, the available stock concentrations of these components, and the needed working concentrations for the PCR itself. Complete the table by supplying the needed volumes of each component for a single reaction and for the master mix (the first row has been filled in as an example).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY