![Investigating Biology Laboratory Manual (9th Edition)](https://www.bartleby.com/isbn_cover_images/9780134473468/9780134473468_largeCoverImage.gif)
Concept explainers
To determine: How the synthesis of the leading strand be affected if DNA pol I was non-functional and also point out the location of function of DNA pol I in the given figure.
Concept introduction:
DNA is a double-stranded molecule. During its replication, the two parent strands unwind, and each strand acts a template for the synthesis of a new strand. DNA polymerase enzyme adds
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 16 Solutions
Investigating Biology Laboratory Manual (9th Edition)
- I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the…arrow_forwardApplication/ Analysis Explain how the anti-parallel structure of DNA predicts its replication mechanism. Identify the major and minor groove of DNA and explain why they are there. Differentiate between semiconservative, conservative, and dispersive replication. Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.arrow_forwardb. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3arrow_forward
- Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be produce in protein synthesis of the given DNA strand. Identify the (1) complimentary DNA strand, (2) mRNA, (3) tRNA, (4) amino acid sequence, and (5) protein. Use the 1-letter symbol of the amino acids to produced to decode the message.arrow_forwardPicture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?arrow_forwardPage 1 of 3 ZOOM DNA Replication_Protein Synthesis_Mutation Assignment *Please type your answers. 1. DNA synthesis and protein synthesis are two processes that are necessary for the cell. Why are these two processes necessary for the cell? How are they connected to each other? wious 4+ 144arrow_forward
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardMatching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )arrow_forward
- Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substratesarrow_forwardA. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in inarrow_forwardnand portable. 6.5 mm micro-edge 16405U processon USE YOUR SMARTPHONE w micro-edge display design See dnclamers on product bo Revi Vide Fea Sameness and Variety (Mitosis and Meiosis) 161 Spe Example Sup SCAN Expressed using apples, DNA replication looks like this. Go look at the model of DNA on the demonstration table. We have been presenting DNA as a straight ladder, but actually it is twisted on itself like a spiral staircase. This shape is called a heliz. Observe The Chromosome Normally DNA exists as loose strands (chromatin) in the nucleus of a cell. This nuclear DNA sends a message (RNA) to the ribosomes where protein and enzymes are synthesized. When stretched out, the length of one DNA molecule in a human cell is almost 4 cm. However, the cell itself is but a tiny fraction of that size. During cell reproduction the DNA must be able to move around. So it shortens its length by tightly coiling up. In doing so, the DNA strands become wider and are visible under a microscope.…arrow_forward
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337408332/9781337408332_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)