Bio 121 Campbell Biology Truman College
17th Edition
ISBN: 9781323670637
Author: Urry, Cain
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.2, Problem 4CC
Summary Introduction
To determine: How the synthesis of the leading strand be affected if DNA pol I was non-functional and also point out the location of function of DNA pol I in the given figure.
Concept introduction:
DNA is a double-stranded molecule. During its replication, the two parent strands unwind, and each strand acts a template for the synthesis of a new strand. DNA polymerase enzyme adds
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
DNA Replication Drawing
Name:
Using penci, you will draw a representation of DNA replication along the leading and lagging strands.
Follow the directions below, drawing each element in its proper location along the replicating DNA
strand. Once you are sure everything is in the correct place, complete your drawing by adding color to
distinguish objects as separate.
1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up
which is which)
2 Label the replication fork
3. Draw and label helicase
4. Label the overall direction of DNA replication
5. Draw and label single stranded binding proteins
6. Draw and label the leadng strand
7. Draw and label a single DNA polymerase IIl on the leading strand
8. Draw and label an RNA primer on the leading strand
9. Draw and label a DNA polymerase I on the leading strand
10. On the lagging strand, draw and label at least three Okazaki fragments
11. On the lagging strand. draw and label at least two DNA polymerase IIl…
דוידודוודי
www.www.
The above image shows DNA during replication. The new DNA strand build using the top strand as the template would be considered
( Select ]
v strand, whereas the new DNA strand build using the bottom strand as the template would be
considered ( Select)
strand. The lagging strand is synthesized discontinuously and is made up of small
fragments called [Select ]
v fragments. These fragments contain RNA primers synthesized by
[ Select )
( Select)
replaces RNA in the primers with DNA and
[ Select ]
v glues the fragments together to form a continuous strand.
in
to 4 minutes)
The schematic diagram below shows organization of the DNA replication fork. Match parts of the diagram (labeled A-F) with the corresponding term from the answer list (designated
31
parental duplex
5'
3'
fork progression
v A
1Lagging strand
2. An Okazaki tragment
3.Site of action of DNA topoisomerase
4 Leading strand
5. Site of action of DNA helicCase
6.Site of action of DNA ligase
Chapter 16 Solutions
Bio 121 Campbell Biology Truman College
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - What two properties, one structural and one...Ch. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Describe the levels of chromatin packing you'd...Ch. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7. HINT: Refer to the slide show and video lecture on this topic to help you solve this one: Synthesis of RNA primers (priming) Ligation II. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that is four amino acids long. Identify which DNA strands are the coding and the transcribed template strands by circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction of transcription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces to the left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands. READ CAREFULLY: The table gives you the possibility of filling in answers that show transcription from either strand or in either direction. You are only required to fill in the information relevant to ONE PEPTIDE (no others). Refer to the genetic code on the…arrow_forwardApplication/ Analysis Explain how the anti-parallel structure of DNA predicts its replication mechanism. Identify the major and minor groove of DNA and explain why they are there. Differentiate between semiconservative, conservative, and dispersive replication. Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.arrow_forwardb. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3arrow_forward
- Picture is only attached as reference. How does the model attached show DNA Replication?What is the importance of DNA Replication?What will happen if there will be an error during the DNA Replication Process?arrow_forwardDirections: Given the DNA strand below. Decode the hidden message in the proteins that will be produce in protein synthesis of the given DNA strand. Identify the (1) complimentary DNA strand, (2) mRNA, (3) tRNA, (4) amino acid sequence, and (5) protein. Use the 1-letter symbol of the amino acids to produced to decode the message.arrow_forwardPage 1 of 3 ZOOM DNA Replication_Protein Synthesis_Mutation Assignment *Please type your answers. 1. DNA synthesis and protein synthesis are two processes that are necessary for the cell. Why are these two processes necessary for the cell? How are they connected to each other? wious 4+ 144arrow_forward
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardMatching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )arrow_forward
- Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substratesarrow_forwardA. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in inarrow_forwardnand portable. 6.5 mm micro-edge 16405U processon USE YOUR SMARTPHONE w micro-edge display design See dnclamers on product bo Revi Vide Fea Sameness and Variety (Mitosis and Meiosis) 161 Spe Example Sup SCAN Expressed using apples, DNA replication looks like this. Go look at the model of DNA on the demonstration table. We have been presenting DNA as a straight ladder, but actually it is twisted on itself like a spiral staircase. This shape is called a heliz. Observe The Chromosome Normally DNA exists as loose strands (chromatin) in the nucleus of a cell. This nuclear DNA sends a message (RNA) to the ribosomes where protein and enzymes are synthesized. When stretched out, the length of one DNA molecule in a human cell is almost 4 cm. However, the cell itself is but a tiny fraction of that size. During cell reproduction the DNA must be able to move around. So it shortens its length by tightly coiling up. In doing so, the DNA strands become wider and are visible under a microscope.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY