CONNECT ACCESS FOR BIOL 01204 <C>
12th Edition
ISBN: 9781264443123
Author: Raven
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 1IQ
Summary Introduction
To explain: The way in which creation of cDNA would be good if a copy of the section of a eukaryotic genome containing exons and introns is required.
Introduction: Exons and introns are the
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Explain (in one or two lines) the function of the followings:(a) Promoter(b) tRNA(c) Exons
Refer to the double stranded DNA molecule with the sequence below to answer the following questions:
5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’
3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’
Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning.
What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.
DNA strand:
mRNA:
amino acid sequence:
The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the
transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram.
Motivate your answers.
(i)
the template and the non-template strands;
(ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand;
(iii) the location of a possible promotor sequence;
(iv) the location of a possible Shine-Dalgarno sequence;
(v)
the specific area of activity of a RNA polymerase.
Chapter 17 Solutions
CONNECT ACCESS FOR BIOL 01204 <C>
Ch. 17.1 - Prob. 1LOCh. 17.1 - Prob. 2LOCh. 17.1 - Describe the construction and uses of recombinant...Ch. 17.2 - Relate the process of DNA replication to PCR.Ch. 17.2 - Compare and contrast PCR, RT-PCR, and quantitative...Ch. 17.3 - Prob. 1LOCh. 17.3 - Prob. 2LOCh. 17.3 - Describe the pros and cons of RNA interference and...Ch. 17.4 - Explain how the universal nature of the genetic...Ch. 17.4 - Compare and contrast knockout, knockin, and...
Ch. 17.4 - Prob. 3LOCh. 17.5 - Describe the benefits of biofuel production from...Ch. 17.5 - Prob. 2LOCh. 17.5 - Prob. 3LOCh. 17.6 - Prob. 1LOCh. 17.6 - Compare and contrast FISH and gene chip...Ch. 17.6 - Describe how immunoassays can be used to diagnose...Ch. 17.7 - Describe the benefits of creating transgenic...Ch. 17.7 - Prob. 2LOCh. 17.7 - Evaluate issues on each side of the transgenic...Ch. 17 - Prob. 1DACh. 17 - Prob. 2DACh. 17 - Prob. 1IQCh. 17 - Prob. 2IQCh. 17 - You study a gene known to be important in the...Ch. 17 - What is the basis of separation of different DNA...Ch. 17 - Prob. 3UCh. 17 - FISH analysis of a breast tumor biopsy for HER2...Ch. 17 - In terms of studying gene function, what is the...Ch. 17 - The Ti plasmid of Agrobacterium usually induces...Ch. 17 - Prob. 1ACh. 17 - Which of the following statements is accurate for...Ch. 17 - Prob. 3ACh. 17 - Many human proteins, such as hemoglobin, are only...Ch. 17 - Amyloid beta is a proteolytic product of a protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?arrow_forwarda molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardGiven: eukaryotic cells can make different proteins, using only one gene. How can a eukaryotic cell make different final proteins from the same gene? Note: some of the answers are actually correct statements, but they don't have anything to do with this question. A.Eukaryotes have 3 RNA polymerases instead of just one. B.Eukaryotes cannot perform simultaneous transcription and translation. C.Eukaryotes splice RNA and can do so in various arrangements. D.Eukaryotes lack the Shine Delgarno sequence.arrow_forward
- The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA sequence 1: CTTTTTTGCCAT DNA sequence 2: ACATCAATAACT DNA sequence 3: TACAAGGGTTCT Determine the mRNA sequence that you would derive from transcription of each strand Using the genetic code table, show the amino acid sequence that will be encoded by these mRNAs For the 3 DNA sequence, what will be the sequence of the complementary base after the process of replication?arrow_forwardYou’re going for a bike ride, and as your muscles work harder, your body needs to produce more of the enzyme. You now know genes are transcribed from DNA into RNA in the nucleus and translated from RNA into proteins by ribosomes. Explain the steps of its creation from DNA to protein. Aside for having a nasty inhibitor around like the one from that insecticide, how else might an enzyme end up being non-functioning? During transcription, a base substitution occurred. Explain two reasons why this change in nucleotide sequence could result in no change to the protein.arrow_forwardA template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate sequence could be transcribed instead of the template sequence. Draw the nontemplate sequence in 3’-5’ order (because remember you have to flip it for your brain to read it like RNA Polymerase would J). Then draw the mRNA sequence and translate it using Figure 14.6 (or any codon chart). Predict how well the protein synthesized from the nontemplate strand would function if at all.arrow_forward
- Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different bases. How many amino acids could be encoded by this variant of the genetic code?arrow_forwardThe design of antibiotics requires that the drug prevents the growth of bacteria without compromising cellular functions in humans. I’d like you to think of the differences in the process of gene expression in prokaryote and eukaryotes and suggest two possible targets for the design of an antibiotic. Explain what processes you are preventing (you can include replication if you’re familiar with this process) and how your drug would be targeted to affect prokaryotes only.arrow_forwardA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forward
- The diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA. IMAGE a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand (upper or lower) is the template for lagging strand synthesis c. Indicate the nucleotide sequence of the RNA that was transcribed from the DNA region specified by the sequence. Label the 5' and 3' ends of this sequence.arrow_forwardConsider how histone proteins bind to DNA and then explain why a salt solution with a high concentration can remove them from DNA (as shown in Figure 12.21b).arrow_forwardHydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license