To review:
The deoxyribonucleic acid (DNA) molecule that denatures first on heating from the given two deoxyribonucleic acid (DNA) molecules, and the reason behind its early denaturation.
Introduction:
The deoxyribonucleic acid (DNA) molecule has a double helical structure that is stabilized by different forces. These forces include hydrophobic interactions, hydrogen bonds, base stacking, and electrostatic interactions.
Explanation of Solution
The second DNAmolecule denatures first because it has smaller number of guanine–cytosine (GC) base pairs, and thus less amount of GCcontent (37.64%).The GC content is measured by dividing the number of cytosine and guanine
The base stacking interactions in the second molecule are less than the interactions in the first molecule. The GC content for the first molecule is higher (56.25%), and the base stacking is stronger as well. A lower amount of heat energy is required to break down the hydrogen bonds and stacking interactions, in the second molecule, and it denatures earlier than the other DNAmolecule.
The base pairs in the deoxyribonucleic acid (DNA) molecule are joined by hydrogen bonds. There are 3 hydrogen bonds between guanine and cytosine while only 2 hydrogen bonds are present between adenine and thymine. The triple bond between guanine-cytosine is stronger than the double bond between adenine and thymine. More energy is required to denature the DNA molecule since ithas more guanine–cytosine base pairs.
It can be concluded that the second deoxyribonucleic acid molecule denatures first on heating because of comparatively weaker base stacking interactions and lower GCcontent.
Want to see more full solutions like this?
Chapter 17 Solutions
BIOCHEMISTRY (LOOSELEAF)
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardIn a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with G or C? Explain in detail.arrow_forward
- How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?arrow_forwardAssume that an error is made: adenine and guanine are matched as base pairs. What would be the impact on the structure of DNA? What would be the structural impact if adenine and cytosine were paired?arrow_forwardWhich DNA fragment, A, B, C, D, E, or F, is the largest?Which two DNA fragments are the same size? Select all that apply. Which DNA fragment, B, C, D, or E is about the same size as the lengths of the fragment A and fragment F added together?arrow_forward
- You are working in a biotechnology lab and are analyzing DNA. You obtain a sample of a short dodecamer of DNA that contains 12 base pairs. Assume the counterions present in your DNA solution are sodium ions. How many sodium ions must there be per dodecamer? Assume the 5′ end phosphates each bear a–1 charge.arrow_forwardThe relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be estimated by measuring its “melting temperature,” the temperature at which half of the DNA strands have pulled apart. Samples with a high percentage of cytosine-guanine pairs have a higher melting temperature than samples with a high percentage of adeninethymine pairs. Explain why this is so, considering the nature of the bonds that hold the base pairs together (look back at as shown).arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forward
- Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimensional structure of double-stranded DNA?arrow_forwardWhen Chargaff was performing his experiments, the tetranucleotide hypothesis, which stated that DNA was composed of GACT nucleotide repeats, was the most widely accepted view of DNA’s composition. How did Chargaff disprove this hypothesis?arrow_forwardDNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning