Campbell Biology, Books a la Carte Plus Mastering Biology with eText -- Access Card Package (10th Edition)
Campbell Biology, Books a la Carte Plus Mastering Biology with eText -- Access Card Package (10th Edition)
10th Edition
ISBN: 9780133922851
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
100%
Book Icon
Chapter 17, Problem 1TYU

In eukaryotic cells, transcription cannot begin until

(A) the two DNA strands have completely separated and exposed the promoter.

(B) several transcription factors have bound to the promoter.

(C) the 5' caps are removed from the mRNA.

(D) the DNA introns are removed from the template.

Blurred answer
Students have asked these similar questions
In the diagram of transcription shown here, fill in the blanks with the appropriate terms: (a) gene; (b) promoter; (c) terminator; (d) RNA polymerase; (e) mRNA.
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above.  Write the mature mRNA strand after the three modifications?   b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed.  Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA

Chapter 17 Solutions

Campbell Biology, Books a la Carte Plus Mastering Biology with eText -- Access Card Package (10th Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY