Campbell Biology: Custom Edition
Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
bartleby

Concept explainers

bartleby

Videos

Textbook Question
100%
Book Icon
Chapter 17, Problem 1TYU

In eukaryotic cells, transcription cannot begin until

(A) the two DNA strands have completely separated and exposed the promoter.

(B) several transcription factors have bound to the promoter.

(C) the 5' caps are removed from the mRNA.

(D) the DNA introns are removed from the template.

Blurred answer
Students have asked these similar questions
In the diagram of transcription shown here, fill in the blanks with the appropriate terms: (a) gene; (b) promoter; (c) terminator; (d) RNA polymerase; (e) mRNA.
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed.  Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon  D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome  E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien

Chapter 17 Solutions

Campbell Biology: Custom Edition

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY