BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
5th Edition
ISBN: 9781260542233
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 1WIO
Explain why the antibiotics penicillin and polymyxin are not effective against archaea. (Review this chapter's Apply It Now box.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
express some basic evolutionary relationships among groups of microorganisms
i need other answers please explain well do not copy from others or i will downvote
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below:
>UnknownSequence1
GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC
GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Give typed explanation
Chapter 17 Solutions
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
Ch. 17.1 - What are two domains that contain prokaryotes?Ch. 17.1 - Prob. 2MCCh. 17.1 - Prob. 3MCCh. 17.1 - Prob. 4MCCh. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - What does the Gram stain reveal about a cell?Ch. 17.2 - Prob. 4MCCh. 17.2 - Prob. 5MCCh. 17.2 - How are molecular data changing microbial...
Ch. 17.2 - Prob. 7MCCh. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.4 - Prob. 1MCCh. 17.4 - Prob. 2MCCh. 17.4 - What adaptations enable pathogenic bacteria to...Ch. 17.4 - What are some practical uses of bacteria and...Ch. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17 - A prokaryotic cell is one that a. lacks DNA. b....Ch. 17 - Which of these is a distinguishing characteristic...Ch. 17 - What feature distinguishes the cell walls of...Ch. 17 - Prob. 4MCQCh. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Prob. 7MCQCh. 17 - Prob. 8MCQCh. 17 - Explain why the antibiotics penicillin and...Ch. 17 - Give five examples that illustrate how bacteria...Ch. 17 - If you were developing a new "broad-spectrum"...Ch. 17 - Ernst Mayr defined a biological species as a...Ch. 17 - In an article in Nature magazine, Sean Nee wrote...Ch. 17 - Ecosystems rely on nitrogen -fixing bacteria,...Ch. 17 - Prob. 7WIOCh. 17 - Prob. 8WIOCh. 17 - Prob. 9WIOCh. 17 - Prob. 10WIOCh. 17 - Mycobacterium tuberculosis causes most cases of...Ch. 17 - Prob. 1PITCh. 17 - Add autotrophs, heterotrophs, phototrophs, and...Ch. 17 - Prob. 3PITCh. 17 - Prob. 4PITCh. 17 - Prob. 5PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D697149 E-leaming System (Academic) estion 19 Which of the following bacteria contain "Endotoxin" as an important constituent of its structure? ot yet swered Select one: arked out of O a. It is present in both O b. Gram positive bacteria Flag question O c. Fungi O d. All answers are correct O e. Gram negative bacteria stion 20 In our bodies, food is broken down into smaller molecules by catalytic enzymes in the digestive tract to allows yet for easy absorption of nutrients by cells in the intestine. vered Oat bran proteins for example, are broken down by pepsin enzyme, by which reaction does this process happen and which chemical bonds will be broken down? ked out of ag question Select one: O a. Dehydration, covalent bonds O b. Hydrolysis, hydrogen bond Oc. Condensation, peptide bods O d. Hydrolysis, covalent bonds O e. Dehydration, hydrophobic interactionsarrow_forwardGive typed full explanation Using a reference source, describe the contributions of the following men made to medicine, especially regarding surgical asepsis: 1. Ignaz Semmelweis 2. Louis Pasteur 3. Joseph Listerarrow_forwardProvide evidence in supporting or refuting the following statement: The cell, or cytoplasmic membrane, is a nonessential structure in bacteria because its function is replaced by the cell wall in these microbes. provide at least 400 of wordsarrow_forward
- Please help,arrow_forwardconsider the following terms: Envelope Fusion Gene therapy Pathogen Vaccine Capsule Decomposer Epidemic Mold Spore Yeast Choose 2 terms from the list and answer the following questions for each term: What familiarity and prior knowledge do you have about the term? What does the term mean in everyday language to everyday people? Use examples to help describe your thoughts. How do people use the word? What does the term mean in technical language to biologists? How is the term related to the course student learning outcome: Describe classifications of biological diversity? What are the similarities and differences between the everyday and technical meanings and uses of the term? What impact might the similarities and differences have on your learning of biology concepts in this course?arrow_forwardWrite a paragraph for when you once have Neisseria gonorrhoea bacteria in its pure form, what methods can you use to confirm the identity of this bacterium as N. gonorrhoeae? Mention what is the principle of those methods.arrow_forward
- Hello, please read the attached Microbiology question and answer both parts correctly. Please explain your answer. *If you correctly answer the question and its two parts, I will provide a Thumbs Up to you. Thank you.arrow_forwardThis bacterium is a gram positive rod. It is negative for the catalase reaction but does produce gas from glucose. What is it?arrow_forwardHello, please read the attached Microbiology question and answer correctly. Please explain your answer. *If you correctly answer the question, I will provide a Thumbs Up to you. Thank you.arrow_forward
- Give typing answer with explanation and conclusion The antibiotic bacitracin binds to bactoprenol after it inserts a peptidoglycan monomer into a bacterial cell wall. Explain why this would lead to the death of the bacterium. 2. Penicillin antibiotics bind the bacterial enzyme transpeptidase. Explain why this would lead to the death of the bacterium. 3. Could either of the above antibiotics be used to treat protozoan infections such as giardiasis & toxoplasmosis? Why/Why notarrow_forwardNote that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is one experiment you could do, involving culturing the organism?arrow_forwardNote that it is not appropriate to self-diagnose outside of a medical context and this is a completely hypothetical scenario. Imagine you have a rash on your foot. You're concerned that it's an infection and inoculate a sample onto an agar plate. You wonder, How can I figure out whether the pathogen is a bacterium vs a eukaryote? You decide to use lab supplies to get a basic understanding of the pathogen. Be specific about what tests you use and what you expect the results to be. Limit yourself to experiments we could do in our lab. What is a procedure you could do, involving making a slide of the organism?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Explore Terrestrial Habitats - Types of Habitats for Children; Author: Smile and Learn - English;https://www.youtube.com/watch?v=vv1indKgOHQ;License: Standard youtube license