EBK HUMAN BIOLOGY
8th Edition
ISBN: 8220102019683
Author: Johnson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 5TY
Which of the following are listed in order from largest, most inclusive, to smallest?
a. genome–chromosome–
b. gene–nucleotide–chromosome–genome
c. chromosome–genome–nucleotide–gene
d. genome–chromosome–gene–nucleotide
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Each of these six terms fits into one (and only one) of the following blanks:
bases, proteins, amino acids, genes, chromosomes, codons.
Write the letter corresponding to each space and then write which of the five terms goes with that letter. For instance, if you think the answer to space “a” is “chromosomes,” write a = chromosomes.
DNA is found on pairs of ______a_______. ______b_______ are series of three _____c_____ that code for particular _____d_______. _____e_____ are specific strings of codons. Amino acids are put together to form ________f______.
1) Translate a mRNA sequence into a protein sequence using the genetic code.
2) write the complementary base pairs for a single strand of DNA.
Which of the following is the correct order of organization of genetic material from largest to smallest?a) Genome, chromosome, gene, nucleotideb) Nucleotide, gene, chromosome, genomec) Gene, nucleotide, chromosome, genomed) Chromosome, genome, nucleotide, gene
Chapter 17 Solutions
EBK HUMAN BIOLOGY
Ch. 17 - How do you feel about the creation and then...Ch. 17 - How far should we go–to what lengths and at what...Ch. 17 - Describe how DNA is replicated before cell...Ch. 17 -
2. Compare and contrast the processes of...Ch. 17 - Explain what mutations are and the role of DNA...Ch. 17 - Name the four phases of mitosis and describe...Ch. 17 -
5. Explain why only one large egg is formed...Ch. 17 - Describe what is meant by selective gene...Ch. 17 - Explain how factors present in the environment can...Ch. 17 - Describe how ribosomes contribute to the formation...
Ch. 17 - Prob. 9CRCh. 17 - Prob. 10CRCh. 17 - What would be the outcome if a cell completed...Ch. 17 - Prob. 2TYCh. 17 - Prob. 3TYCh. 17 - Prob. 4TYCh. 17 - Which of the following are listed in order from...Ch. 17 - Prob. 6TYCh. 17 - Which is likely to be the shortest chain of...Ch. 17 - How many different amino acids could be encoded if...Ch. 17 - Prob. 9TYCh. 17 - Why do cells within an organism differentiate,...Ch. 17 - Which method of cloning is most similar to the way...Ch. 17 - Prob. 12TYCh. 17 - Prob. 13TYCh. 17 - Prob. 14TYCh. 17 -
15. How does the production of sperm differ from...Ch. 17 - Prob. 1AWKCh. 17 - Prob. 2AWKCh. 17 - Prob. 3AWKCh. 17 - Prob. 4AWKCh. 17 - Mitochondria contain their own DNA that is...Ch. 17 - Bacteria can reproduce by simple cell division....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. How many different DNA strands composed of100 nucleotides could possibly exist?b. How many different proteins composed of100 amino acids could possibly exist?arrow_forwardWhich of the following combinations are true of the nucleotide composition of a sample of DNA? SELECT ALL ANSWERS THAT APPLY* C = A and G = T A +T = G+ C AxC = G x T A=T and C = G A-T= G-C A+C = G+ T DNA is made up of deoxyribose sugar, phosphate group and a nitrogen base. DNA is the genetic material that determines the traits of living things and is O O Oarrow_forwardIf DNA analysis of a gene shows it has 20% adenine (A), what percent of the other bases does it have? Cytosine (C): Guanine (G): Thymine (T): Uracil (U): 6. Now for a sense of size. Rank the following from smallest (1) to largest (6): gene, cell, chromosome, atom, nucleus, nucleotidearrow_forward
- You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you transcribe mRNA from the DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA transcripts. You obtain the following results: A G C T UDNA strand #1 19.1 26.0 31.0 23.9 0DNA strand #1 24.2 30.8 25.7 19.3 0mRNA 19.0 25.9 30.8 0 24.3Which strand of the DNA is the “sense” strand that serves as the template for mRNA synthesis?arrow_forwardTranscribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.arrow_forwardBackground: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded, arrangement (i.e. the double helix) within the nucleus of every cell. This structure makes the process of replication that occurs prior to mitosis and meiosis very reliable. The purpose of DNA, though, is not simply to make copies of itself, but to provide a set of instructions for the synthesis or "construction" of biomolecules, such as proteins. Why is transcription (i.e. the formation of an RNA copy of a given gene) a necessary step in the "construction" process highlighted above? What is the cell looking to ultimately do with this RNA information?arrow_forward
- You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forwardLabel each statement as pertaining to DNA, RNA, or both. a. The polynucleotide is double stranded. b. The polynucleotide may contain adenine. c. The polynucleotide may contain dGMP. d. The polynucleotide is a polymer of ribonucleotides.arrow_forwardState the 4 criteria which a molecule must fulfill to act as a genetic material.arrow_forward
- Explain how a genetic map (in map units) is related to actual physical distance (in base pairs of DNA)?arrow_forwardExplain the sequence of the four letters of the DNA alphabet?arrow_forwardEach cell of the human body contains 46 chromosomes. How many DNA molecules does this statement represent? How many different types of DNA molecules does it represent?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license