HUMAN BIOLOGY: CONCEPTS - 9780134312729
8th Edition
ISBN: 2819260095972
Author: Johnson
Publisher: PERUSALL
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 17, Problem 7TY
Which is likely to be the shortest chain of
a. the DNA of a gene
b. the primary transcript of the gene
c. the mRNA
d. DNA, the primary transcript of the gene, and mRNA all contain the same number ofnucleotides.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA editing c. splicing d. 7-methylguanosine cap
Which type of gene controls functions like an "on-off" switch for gene transcription?
A. DNA methylation
B. Phosphorylation
C. translation
D. protein degradation
Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs
b. introns
c. stop codon
d. AUG codon
Chapter 17 Solutions
HUMAN BIOLOGY: CONCEPTS - 9780134312729
Ch. 17 - How do you feel about the creation and then...Ch. 17 - How far should we go–to what lengths and at what...Ch. 17 - Describe how DNA is replicated before cell...Ch. 17 -
2. Compare and contrast the processes of...Ch. 17 - Explain what mutations are and the role of DNA...Ch. 17 - Name the four phases of mitosis and describe...Ch. 17 -
5. Explain why only one large egg is formed...Ch. 17 - Describe what is meant by selective gene...Ch. 17 - Explain how factors present in the environment can...Ch. 17 - Describe how ribosomes contribute to the formation...
Ch. 17 - Prob. 9CRCh. 17 - Prob. 10CRCh. 17 - What would be the outcome if a cell completed...Ch. 17 - Prob. 2TYCh. 17 - Prob. 3TYCh. 17 - Prob. 4TYCh. 17 - Which of the following are listed in order from...Ch. 17 - Prob. 6TYCh. 17 - Which is likely to be the shortest chain of...Ch. 17 - How many different amino acids could be encoded if...Ch. 17 - Prob. 9TYCh. 17 - Why do cells within an organism differentiate,...Ch. 17 - Which method of cloning is most similar to the way...Ch. 17 - Prob. 12TYCh. 17 - Prob. 13TYCh. 17 - Prob. 14TYCh. 17 -
15. How does the production of sperm differ from...Ch. 17 - Prob. 1AWKCh. 17 - Prob. 2AWKCh. 17 - Prob. 3AWKCh. 17 - Prob. 4AWKCh. 17 - Mitochondria contain their own DNA that is...Ch. 17 - Bacteria can reproduce by simple cell division....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new moleculesarrow_forwardChoose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. intronsarrow_forwardWhat feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the electrical charges of its phosphate groups b. its nucleotide sequence c. the hydrogen bonds between its base pairs d. its double helix shapearrow_forward
- A mutation in which of these proteins will lead to increased mutations in all daughter cells? A. helicase B. topoisomerase C. ligase D. DNA polymerasearrow_forwardHow many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48arrow_forwardWhat is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNAarrow_forward
- Which enzyme is responsible for the synthesis of pre-mRNA? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III D. RNA polymerasearrow_forwardMutation occurs in which part of the central dogma process? a. replication b. transcription c. transation d. synthesisarrow_forwardHow many initiation codons are there? a. 1 b. 3 c. 4 d. 20arrow_forward
- Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA molecule. B. When a tRNA has an amino acid attached to it, it is considered to be a charged tRNA C. Synthetases are not important to tRNA D. Amino acids are linked to tRNAs with hydrogen bondsarrow_forwardWhich answer correctly compares the primary transcript in a prokaryotic cell with the functional MRNA? O the primary transcript and the MRNA both contain introns O the primary transcript is smaller than the MRNA O the primary transcript is larger than the MRNA none of these O the primary transcript is the same size as the MRNAarrow_forwardDerive the complementary mRNA and the polypeptide sequence of the DNA strand below. 5’GCTATAAAGCGTATCGCGTCATA 3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
The Plant Kingdom: Characteristics and Classification | Educational Videos for Kids; Author: Happy Learning English;https://www.youtube.com/watch?v=IYxfz1PSfZ0;License: Standard Youtube License