Investigating Biology Laboratory Manual (9th Edition)
Investigating Biology Laboratory Manual (9th Edition)
9th Edition
ISBN: 9780134473468
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Judith Giles Morgan, M. Eloise Brown Carter
Publisher: PEARSON
Question
Book Icon
Chapter 17.1, Problem 3CC
Summary Introduction

To draw: The mRNA sequence transcribed from the non-template strand of a gene as well as its translated sequence.

Concept introduction:

The genetic information of DNA is encrypted in the nucleotide base sequences. These sequences are transcribed into mRNA triplets and are called codons. These mRNA triplet nucleotides are then translated to form a polypeptide.

Blurred answer
Students have asked these similar questions
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above.  Write the mature mRNA strand after the three modifications?   b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?

Chapter 17 Solutions

Investigating Biology Laboratory Manual (9th Edition)

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning