BIOLOGY
BIOLOGY
5th Edition
ISBN: 9781264104680
Author: BROOKER
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 17.5, Problem 1CS
Summary Introduction

To create: A pair of models that depict the key difference between the forms of glycosyltransferase encoded by the IA and IB alleles.

Introduction: Blood type is determined by a gene that has three different alleles. This gene codes for an enzyme called glycosyltransferase, this enzyme is useful for the synthesis of a specific polysaccharide on the surface of red blood cells.

Blurred answer
Students have asked these similar questions
a. Why does a shift from grain to meat diets create more demand for cereals? b. What is the name of this emerging area of research where a 250kg cow produces 200g of protein every day but 250g of Methylophillus methylotrophus can produce 25 tonnes of protein? State the advantages of this area of research.
Exercise Ill: For this lab exercise, you will evaluate a human pedigree for a particular disease, Huntington disease. Huntington disease is a progressive neurodegenerative disorder that is inherited in an autosomal dominant pattern. The disease presents around the age of 40, although there are juvenile onset forms of the disease. Suppose that there is a SNP closely linked to the Huntington gene, so close that there is little crossing over between the SNP and the Huntington gene. Consider the following family: Velma's father, now deceased, had Huntington Disease, but neither of his parents had the disease; therefore, it was a new mutation that caused his disease. Velma's mother does not have the disease. Before his death, Velma's father was genotyped for the SNP marker that is linked to the Huntington gene, and it was determined that he has alleles A1 and A2. Velma's mother was also genotyped and has alleles A1 and A3. Velma has one brother (age 45) who has Huntington Disease, and…
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue). What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License