EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17.5, Problem 3CC
WHAT IF? DRAW IT → The template strand of a gene includes this sequence:
3'-TACTIGTCCGATATC-5'. It is mutated to 3'-TACTIGTCCAATATC-5'. For both wild-type and mutant sequences, draw the double-stranded DNA, the resulting mRNA, and the amino acid sequence each encodes. What is the effect of the mutation on the amino acid sequence?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
HELP PLEASE !!
In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
construct! Which of the four constructs
(Construct 1-4) below could you use to make
your own mouse knockout? For each one
you did not choose, explain why you did not
choose that construct. Part of DHCR7 gene
structure is shown on top row in the
schematic. (Antibiotic selection and negative
selection genes have been abbreviated.)
Gene DHCR7
Intron 1
Exon 2
Intron 2
Exon 3
Exon1
Construct #1
Construct #2
Intron1 Negative Sel.
Intron1
|Antibio. Sel. Negative Sel.
Intron2
Antibio. Sel
Intron 2
Construct #3
Construct #4
Introni Antibio. Sel Negative Sel.
Negative Sel.
Antibio. Sel.
Intron2
Intron1
Intron2
Chapter 17 Solutions
EBK CAMPBELL BIOLOGY
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.1 - Prob. 4CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - Prob. 3CCCh. 17.3 - Prob. 1CCCh. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CC
Ch. 17.4 - What two processes ensure that the correct amino...Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - Prob. 4CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - Prob. 11TYUCh. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Physiology a. deals with the processes or functions of living things. b. is the scientific discipline that inve...
SEELEY'S ANATOMY+PHYSIOLOGY
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?arrow_forwardYes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?arrow_forward
- Q10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forwardRemember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutationarrow_forwardRemember: for every DNA and RNA sequence you determine in this assignment, do not forget to indicate the 5' and 3' ends The following is the DNA template strand for a specific gene. The sequence does not include a promoter region or the terminator region. 3' | A|C|A| |GT|G|T|ATAA A A CC G|CGIIT TCTCC|AG|CT|T|G|C|G|G|G| G|G|A|T|T|G|C|G|C|A |A G CCAAA|G|ACAA|TAGG|ATACGTA |ATCTTT| 5' 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the MRNA primary transcript sequence 5' GGG AUG UCA CÁC AUA UUU 1 2 3 4 5 6arrow_forward
- TRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardGreat! Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? O Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries O l use a comparative genomic approach and use sequence homology with the genome of a closely related species O luse a comparative genomic approach and use sequence homology with the genome of a distantly related species O Both A and B O Both B and Carrow_forward
- Need help 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely target a particular gene with an RNA of this size, consider the following calculation: what is the expected frequency of occurrence of a specific 18 nucleotide sequence? a.The probability of finding this sequence is ___ . b.Therefore, the frequency of occurrence of this sequence is one in ___ nucleotides. c.The fruit fly genome consists of 1.2×108 base pairs.Using the logic in part a., calculate the minimum length of a unique DNA sequence expected to occur by chance just once in the fruit fly genome. Length = __ base pairsarrow_forwardOpen reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forwardYes or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr generate linear moleyof dna? in situ hybridization reveals distribution of a gene's mrna in an organism.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY