BIOLOGY 12TH ED (LL) W/ CONNECT
12th Edition
ISBN: 9781264898091
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 1S
You are in the early stages of a genome-sequencing project. You have isolated a number of clones from a bacterial artificial chromosome (BAC) library and mapped the inserts in these clones using STSs. Use the STSs shown to align the clones into a contiguous sequence of the genome (a contig).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment.
Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers.
Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand).
Please organize your response so that each primer, and associated information, is separated by at least one blank line
5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
A real-time polymerase chain reaction is a laboratory technique of molecular biology based
on the polymerase chain reaction. This technique detects the fluorescence produced by
reporter molecules like SYBR® Green dye or TaqMan® probe during the DNA amplification
reaction. Compare and contrast between SYBR® Green and TaqMan® probe with
illustrations.
Chapter 18 Solutions
BIOLOGY 12TH ED (LL) W/ CONNECT
Ch. 18.1 - Prob. 1LOCh. 18.1 - Describe the pros and cons of restriction mapping,...Ch. 18.1 - Prob. 3LOCh. 18.2 - Discriminate between dideoxy terminator sequencing...Ch. 18.2 - Prob. 2LOCh. 18.3 - Describe the findings of the Human Genome Project.Ch. 18.3 - Prob. 2LOCh. 18.3 - Prob. 3LOCh. 18.4 - Prob. 1LOCh. 18.4 - Prob. 2LO
Ch. 18.4 - Prob. 3LOCh. 18.5 - Prob. 1LOCh. 18.5 - Prob. 2LOCh. 18.5 - Prob. 3LOCh. 18.6 - Prob. 1LOCh. 18 - Prob. 1DACh. 18 - If the human genome contains approximately 3...Ch. 18 - Prob. 1IQCh. 18 - Prob. 2IQCh. 18 - Prob. 3IQCh. 18 - Prob. 4IQCh. 18 - Prob. 5IQCh. 18 - Prob. 6IQCh. 18 - A genetic map provides a. the sequence of the DNA...Ch. 18 - Prob. 2UCh. 18 - Approximately how many genes are there in the...Ch. 18 - An open reading frame (ORF) is distinguished by...Ch. 18 - What is a BLAST search? a. A mechanism for...Ch. 18 - Prob. 6UCh. 18 - Prob. 7UCh. 18 - Prob. 8UCh. 18 - Prob. 1ACh. 18 - Prob. 2ACh. 18 - Prob. 3ACh. 18 - Prob. 4ACh. 18 - What information can be obtained from a DNA...Ch. 18 - Prob. 6ACh. 18 - Prob. 7ACh. 18 - You are in the early stages of a genome-sequencing...Ch. 18 - Genomic research can be used to determine if an...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced fragments below, to determine the order of the fragments and the complete sequence.arrow_forwardYou have two samples you have to sequence: one is a cloned plasmid that you want to verify the sequence of, and another is the cDNA library of the transcriptome of a cell. Which method would you use for each sample and why?arrow_forwardWhat is the main reason for using a cDNA library rather than a genomic library to isolate a human gene from which you wish to make large quantities of the human protein in bacteria? How will you identify clones of interest?arrow_forward
- Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the genome, resulting in 20 reads, with an average length of 50 bp. A very important point is that, even though 20×50 = 1000, there is no guarantee that ALL 1000 bp of the genome are represented in the fragments. Calculate the coverage. What does this value mean? Why would it be a good idea to have a coverage greater than 1?arrow_forwardwhat is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forward
- How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATTarrow_forwardfomP is responsible for the chemical transformation of microplastics into ultra-efficient insulation. You take an arctic seawater sample and extract the DNA. 1. First you need to locate the gene on the bacterial chromosome. What procedure(s) would you use to identify and locate the gene? Explain how it/theywork(s). 2. Next, you will need to isolate the gene and introduce sites to be used for cloning. What would you use to make many copies of this gene? What will you need? How does it work on a molecular level?arrow_forwardWhat can serve as footprints to identify genome sites that are or have been occupied by transposable elements? options: SNPs Microsatellite DNA Transposase Transposable DNA elements at the insertion sitearrow_forward
- An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thxarrow_forwardHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?arrow_forwardList the steps to make a genomic library. What steps would change if you wanted to make a cDNA library instead?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License