ESSENTIALS OF GENETICS MCC BUNDLE >BI<
9th Edition
ISBN: 9781323915370
Author: KLUG
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18, Problem 20PDQ
Summary Introduction
To review:
The following regarding the exome sequencing procedure used in diagnosing genetic conditions:
(a) The strengths and weaknesses of exome sequencing.
(b) Whether an analysis of the patient’s mitochondrial genome would be included while ordering exome sequencing of a patient or not.
Introduction:
Exome sequencing is a technique used to sequence exons present in the genome of an individual. Exon sequencing helps in revealing mutations that cause diseases by considering only exons as exons are the protein-coding segments in the genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the main reason for using a cDNA library rather than a genomic library to isolate a human gene from which you wish to make large quantities of the human protein in bacteria? How will you identify clones of interest?
Why the DNA sequencing alone is often not sufficient to produce a genome assembly of desired reference-grade quality, particularly in eukaryotic organisms?
Now that you understand how the CRISPR-Cas9 system works, think back to the experiments discussed in the introduction to this chapter, in which researchers used CRISPR-Cas9 genome editing to treat mice with Duchenne muscular dystrophy. Why did the researchers choose to cut out the entire exon 23 in the mice with the disorder? Why not replace the specific mutation using a donor piece of DNA and homologous recombination? Propose some possible explanations.
Chapter 18 Solutions
ESSENTIALS OF GENETICS MCC BUNDLE >BI<
Ch. 18 -
CASE STUDY | Your microbiome may be a risk factor...Ch. 18 - CASE STUDY|Your microbiome may be a riskfactor for...Ch. 18 -
CASE STUDY | Your microbiome may be a risk...Ch. 18 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 18 - Review the Chapter Concepts list on page 345. All...Ch. 18 - Prob. 3PDQCh. 18 - Prob. 4PDQCh. 18 - Prob. 5PDQCh. 18 - Prob. 6PDQCh. 18 - Prob. 7PDQ
Ch. 18 -
8. BLAST searches and related applications are...Ch. 18 - Describe the human genome in terms of genome size,...Ch. 18 - Prob. 10PDQCh. 18 -
11. Annotation involves identifying genes and...Ch. 18 - Through the Human Genome Project (HGP), a...Ch. 18 -
13. Describe the significance of the Genome 10K...Ch. 18 - Prob. 14PDQCh. 18 - Prob. 15PDQCh. 18 - Prob. 16PDQCh. 18 -
17. Annotation of the human genome sequence...Ch. 18 - Prob. 18PDQCh. 18 - Prob. 19PDQCh. 18 - Prob. 20PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are performing an experiment using CRISPR-cas9 to genetically modify the LacZ gene of a culture of E. coli. After you run the experiment, you decide to use gel electrophoresis to genotype the different bacterial cultures to determine if the gene editing was successful. How could your electrophoresis results confirm that the PCR was successful? And how could your electrophoresis results confirm that you successfully extracted genomic DNA from your bacterial samples?arrow_forwardWhat key structural features of the DNA molecule underlie its ability to be faithfully replicated?arrow_forwardYour advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forward
- "Whole-Genome Sequencing Is Widely Used for Sequencing and Assembling Entire Genomes". Explain this ?arrow_forwardApproximately what portion of the human genome is composed of repeat sequences?arrow_forwardWhy do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas geneticistsstudying bacteria almost never do? Why might bacterial geneticists have difficulties constructing cDNA libraries even if they wanted to?arrow_forward
- In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardHi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?arrow_forwardDuring your experiment you analysed only a few of the recombinant clones for the presence of the highly repeated Aluelements. If you wanted to screen for a single-copy gene, you would need to screen a much larger genomic library. Assuming, that you already know the amino acid sequence of unicorn (a species with a similar physiology to humans) insulin, how would you construct a probe which would enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for the insulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors, enzymes, and DNA sequencers.arrow_forward
- If I clone a complete eukaryotic gene, including the eukaryotic promoter region, ligate it into a plasmid, and transform it into E. coli, will I be able use the transformed E. coli to make the corresponding protein? Explain why, or why not? If you decide to do this, what would your cloning strategy be?arrow_forwardWhy is the term “proteome” ambiguous, whereas the term“genome” is not?arrow_forwardWhy is Sanger sequencing sometimes referred to as "dye-terminator" sequencing?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License