Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
12th Edition
ISBN: 9780134811390
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18, Problem 2PDQ
CONCEPT QUESTION Review the Chapter Concepts list on page XXX. The third concept describes how the interaction between cis-acting sequence elements on mRNA and trans-acting RNA-binding proteins (RBPs) regulates mRNAs and gene expression. Write a short essay describing how an mRNA may be regulated in three different ways by specific cis-elements and RBPs.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Describe some of the ways in which mRNAs might regulate gene expression. What is the role of poly(A) in mRNA stability? How might the cell regulate the stability Different mRNAs?
Compare and contrast the properties and roles of siRNAs and miRNAs in RNA interference. Be sure to describe how these two types of small RNA are generated, what types of mRNAs they target, and what happens to the targeted mRNAs. What aspects of these processes are the same? And what aspects are different?
Chapter 18 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
Ch. 18 - Some mutations in the tra gene of Drosophila cause...Ch. 18 - Some scientists use the analogy that the...Ch. 18 - Consider the example that actin mRNA localization...Ch. 18 - What is alternative splicing, where does it occur,...Ch. 18 - What role might the expanded tri- and...Ch. 18 - DM1 is characterized by a phenomenon known as...Ch. 18 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 18 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 18 - List three types of alternative splicing patterns...Ch. 18 - Consider the CT/CGRP example of alternative...
Ch. 18 - Explain how the use of alternative promoters and...Ch. 18 - Explain how a tissue-specific RNA-binding protein...Ch. 18 - The regulation of mRNA decay relies heavily upon...Ch. 18 - Nonsense-mediated decay is an mRNA surveillance...Ch. 18 - AU-rich elements (AREs) are cis-elements in mRNAs...Ch. 18 - What are processing bodies (P bodies), and what...Ch. 18 - In 1998, future Nobel laureates Andrew Fire and...Ch. 18 - Present an overview of RNA interference (RNAi)....Ch. 18 - RNAi may be directed by small interfering RNAs...Ch. 18 - Prob. 14PDQCh. 18 - In principle, RNAi may be used to fight viral...Ch. 18 - Prob. 16PDQCh. 18 - Prob. 17PDQCh. 18 - Prob. 18PDQCh. 18 - Prob. 19PDQCh. 18 - How is it possible that a given mRNA in a cell is...Ch. 18 - Prob. 21PDQCh. 18 - Prob. 22PDQCh. 18 - Prob. 23PDQCh. 18 - Prob. 24ESPCh. 18 - Prob. 25ESPCh. 18 - Mutations in the low-density lipoprotein receptor...Ch. 18 - RNA helicases are a class of proteins that bind...Ch. 18 - While miRNA response elements (MREs) may be...Ch. 18 - RNAi is currently being tested as a therapeutic...Ch. 18 - The localization and translational control of...Ch. 18 - Explain how the expression of a single gene can be...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- List and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forwardChoose any/all that apply to mRNA processing in eukaryotes. The "starter/initiator" methionine codon is added to the 5' end of each mRNA molecule during post-transcriptional processing. The entirety of every mRNA transcript is always translated to protein. The 5' m'G cap interacts with the 3' poly (A) tail (via initiation factors and other proteins) to circularize an mRNA as part of the initiation of protein translation. mRNA processing occurs while genes are actively being transcribed.arrow_forwardA monocistronic mRNA is defined by… Group of answer choices The presence of a 5’ triphosphate The absence of introns The presence of one coding sequence The absence of a poly(A) tail Eukaryotic mRNAs are protected on the 5’ end by… Group of answer choices A methylated guanosine A polymer of adenine A triphosphate RNA primer Eukaryotic mRNAs are typically processed in this order: Group of answer choices Introns spliced out, poly(A) tail added, capped Poly(A) tail added, capped, introns spliced out Capped, poly(A) tail added, introns spliced out Capped, introns spliced out, poly(A) tail addedarrow_forward
- The deadenylation pathway is a critical means of maintaining a steady state level of mRNAs and proteins in the cells. How does deadenylation affect protein synthesis if it works on mRNAs? Options: loss of the poly A tail results in rapid 3'-5' degradation of transcript leading to reduced protein synthesis deadenylation can result in an increased exposure of the cap to enzymes involved in decapping, leading to subsequent 5' mediated degradation it reduces the ability of mRNAs to form 5' 3' circular mRNA structures that protects both termini a and b only a, b and carrow_forwardThe base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.arrow_forwardRNA silencing can be accomplished by specific mRNA degradation or by preventing its translation of the encoded protein. What specific determines which of these two pathways will be followed? It depends on whether the RITS or the RISC complex associates with double-stranded RNA. It depends on whether the single-stranded RNA, associated with RISC, base-pairs perfectly or imperfectly with the target mRNA. It depends on whether Drosha is involved in the process. It depends on whether Dicer is associated with single- or double-stranded RNA. It depends on whether RISC initially binds to single- or double-stranded RNA.arrow_forward
- In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.arrow_forward. One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairingwith the ribosome binding site on the sense mRNA toblock translation. In a second, alternative mechanism,the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing thesense promoter for the same gene. Design an experimental approach that would enable you to distinguishbetween these two modes of action at a specific gene.(Hint: What would be the outcome in each case ifhigh levels of the antisense RNA were transcribedfrom a gene on a plasmid?)arrow_forwardDiscuss the advantages, in terms of protein structure and evolution, that result from alternative mRNA splicing.arrow_forward
- Transcription is currently believed to occur in bursts, whereby increased burst frequency is associated with increased promoter strength and RNA synthesis. What is the evidence that this is occurs in cells? Describe in a stepwise detail how phase separation and condensates might contribute to the bursting phenomenon.arrow_forwardIn eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.arrow_forwardCompare the control of gene regulation in eukaryotes and prokaryotes at the level of initiation of transcription. How do the regulatory mechanisms work? What are the similarities and differences in these two types of organisms in terms of the specific components of the regulatory mechanisms? Address how the differences or similarities relate to the biological context of the control of gene expression.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY