Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
4th Edition
ISBN: 9781259853197
Author: Robert Brooker
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18.5, Problem 3EQ
Gene Transfer Between Bacteria
CoreSKILL » The gene transfer seen in the Lederberg and Tatum experiment could have occurred in one of two ways: by bacteria taking up DNA released into the environment or by contact between two bacterial cells that allowed for direct transfer. Davis conducted an experiment to determine the correct process. Explain how his results indicated the correct gene transfer process.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Based on the images attached, what does the similarity in the sequences tell you about the ermB gene found in these bacteria? Would we expect high or low sequence similarity when considering the possibility of horizontal gene transfer?
BICD100 HW6 Prokaryotic Genetics
Question 1. You are interested in three genes in bacteriophage. The recessive mutant alleles cause
plaque phenotypes that were creatively named fuzzy, shaky, and purple. Another lab published the
following map of the three genes:
fuzzy shaky
2.9
17.4
purple
To verify the published map, you cross a purple shaky phage strain with a fuzzy phage strain by co-
infecting E. coli at a high multiplicity of infection (every bacterium infected with both types of phage).
You plate the resulting lysate and analyze the phenotypes of the plaques caused by the progeny phage.
a. State the genotypes of the two parent phage strains:
b. List all eight of the possible phenotypes that could result from this cross. If 400 phage plaques were
examined from this cross, how many plaques of each of the eight phenotypic classes would you expect?
The terms conjugation, transduction, and transformation are usedto describe three different natural forms of genetic transferbetween bacterial cells. Briefly discuss the similarities and differencesamong these processes?
Chapter 18 Solutions
Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
Ch. 18.1 - Prob. 1CCCh. 18.2 - Prob. 1BCCh. 18.2 - Viral Reproductive Cycles Concept Check: From the...Ch. 18.4 - Prob. 1CCCh. 18.4 - Genetic Properties of Bacteria Core Skill:...Ch. 18.4 - Prob. 2CCCh. 18.4 - Genetic Properties of Bacteria Concept Check:...Ch. 18.4 - Prob. 4CCCh. 18.5 - Prob. 1CCCh. 18.5 - Prob. 1EQ
Ch. 18.5 - Prob. 2EQCh. 18.5 - Gene Transfer Between Bacteria CoreSKILL The gene...Ch. 18.5 - Prob. 2CCCh. 18.5 - Gene Transfer Between Bacteria Core Skill:...Ch. 18.5 - Gene Transfer Between Bacteria Concept Check: Is...Ch. 18 - Prob. 1TYCh. 18 - The characteristics of viral genomes show many...Ch. 18 - During viral infection, attachment is usually...Ch. 18 - Prob. 4TYCh. 18 - Prob. 5TYCh. 18 - Prob. 6TYCh. 18 - Prob. 7TYCh. 18 - Prob. 8TYCh. 18 - Prob. 9TYCh. 18 - Prob. 10TYCh. 18 - How are viruses similar to living cells, and how...Ch. 18 - Prob. 2CQCh. 18 - Prob. 3CQCh. 18 - Prob. 1COQCh. 18 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Droplet based single cell DNA sequencing uses a microfluidic platform which generates droplets encapsulating individual cells. A micrograph of such a device [Zilionis et al, Nature Protocols 2016] is presented in Figure Q3. The channels are 25 μm deep. (a) (b) Oil Figure Q3. Micrograph of the microfluidic droplet device. Scale bars are 100 µm. Adapted from Zilionis et al, Nature Protocols 2016. Red arrowheads show individual cells, and black arrows indicate flow direction. (c) RT/lysis reagents Cells Barcoding hydrogel beads A company wants to explore the design of a prototype of the device made from PDMS. Describe a suitable fabrication process, explaining the rationale behind each individual step. Schematics can be drawn to illustrate your response. You may want to refer to the datasheets at the end of the script. Testing of the prototype was successful and the company wants to explore the feasibility of manufacturing the device from glass. Describe the fabrication process for this…arrow_forwardPrimer Development Pick your favorite gene and develop primers for a target within the gene. Provide the following information: Gene name: Species: Accession number: Primer target: Primer Output: Explain why you selected this primer set.arrow_forwardSCi 7. Superhelical Density Bacteriophage A infects E. coli by wi integrating its DNA into the bacterial chromosome. The suc- cess of this recombination depends on the topology of the E. coli DNA. When the superhelical density (ơ) of the E. coli DNA is greater than -0.045, the probability of integration is <20%; when o is less than -0.06, the probability is –70%. the at lor 10 sic Plasmid DNA isolated from an E. coli culture is found to have is a length of 13,800 bp and an Lk of 1,222. Calculate o for this DNA and predict the likelihood that bacteriophage A will be 14 able to infect this culture. sisarrow_forward
- Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forwardIn relation to DNA Isolation experiment 1. Once the tissue has been ground and heated to 60°C, the DNA is released into the solution, but so are many other types of cellular molecules. List some types of molecules besides DNA that you would expect to find in a cell. 2. What is the role of the detergent in this protocol? How does it perform this function? 3. Name two important functions of the proteases? 4. If you wanted to isolate a copy of the gene that codes for a protein found in the skin, could that gene be located in liver cells? Explain your reasoning 5. What do you think will be the first step in purifying DNA from intact isolated cells? 6. What happened to the other macromolecules once the DNA was precipitated out of solution?arrow_forwardCA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutationarrow_forward
- Provide a brief description behind your choice? Virus-mediated transfer of cellular genetic material from one bacterial cell to another by means of virus particles is called: (A) transduction (B) transposition (C) transformation (D) transfection One strand of double-stranded DNA is mutated, changing all cytosines to uracils. After one round of replication of the mutated DNA strand, the melting temperature of the resulting DNA will: (A) be higher (B) be lower (C) remain the same (D) be double The Southern blotting technique is used for: (A) the detection of RNA fragments onmembranes by specific radioactiveantibodies (B) the detection of DNA fragments onmembranes by a radioactive DNAprobe (C) the detection of proteins on membranesusing a radioactive DNA probe (D) the detection of DNA fragments onmembranes by specific radioactiveantibodies Superoxide dismutase is an important enzyme for maintenance of red blood cells and is defective insome neurodegenerative diseases. What…arrow_forwardMAKE CONNECTIONS Mutagens are chemical andphysical agents that induce mutations in DNA (seeConcept 17.5). How does reduced ozone concentrationin the atmosphere increase the likelihood of mutationsin various organisms?arrow_forwardProtein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forward
- For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?arrow_forward"Complementary DNA (cDNA) libraries offer certain advantages over genomic libraries". Explain how ?arrow_forwardWhat type of enzymes are used to “cut” desired DNA sequences for use in recombinant gene technology experiments? Identify those two enzymes used to cut and paste both genes into the plasmid. Identify all three strategies used in this lab to maximize transformation success. Explain what it means for bacteria to be “competent.” Explains why bacterial competency is this important for this investigation.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license