FUND.OF GEN CHEM CHAP 1-13 W/ACCESS
16th Edition
ISBN: 9781323406038
Author: McMurry
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 19.8, Problem 19.2CIAP
AZT (zidovudine) inhibits the synthesis of the HIV virus RNA because AZT resembles substrate molecules. Which kind of inhibition is most likely taking place in this reaction?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Many patients become resistant to HIV protease inhibitors with the passage of time, owing to mutations in the HIV gene that encodes the protease. Mutations are not found in the aspartate residue that interacts with the drugs. Why not?
The structure of a prodrug used for treating people with HIV virus (human immunodeficiency virus) and AIDS is shown below. This molecule is a precursor of a protease inhibitor that competitively inhibits HIV protease due to its resemblance to the proteolytic site of the enzyme. Which process in the viral life cycle does this inhibitor target directly ?
Group of answer choices
a. viral protein processing for making new viruses
b. viral mRNA synthesis
c. viral DNA integration into the host cell DNA
d. viral DNA synthesis
Are the HIV-1 protease inhibitors transition state analogs? Why or why not?
Chapter 19 Solutions
FUND.OF GEN CHEM CHAP 1-13 W/ACCESS
Ch. 19.1 - Prob. 19.1PCh. 19.1 - The enzyme LDH converts lactate to pyruvate. In...Ch. 19.2 - The cofactors NAD+, Cu2+, Zn2+, coenzyme A, FAD,...Ch. 19.3 - Describe the reactions that you would expect these...Ch. 19.3 - Prob. 19.5PCh. 19.3 - Prob. 19.6PCh. 19.3 - Prob. 19.7PCh. 19.3 - Prob. 19.8PCh. 19.4 - Prob. 19.9KCPCh. 19.5 - Prob. 19.10KCP
Ch. 19.5 - Prob. 19.11PCh. 19.5 - Prob. 19.12PCh. 19.6 - Prob. 19.13PCh. 19.6 - Prob. 19.14PCh. 19.7 - (a) L-Threonine is converted to L-isoleucine in a...Ch. 19.8 - AZT (zidovudine) inhibits the synthesis of the HIV...Ch. 19.8 - Prob. 19.3CIAPCh. 19.8 - Prob. 19.16PCh. 19.9 - Does the enzyme described in each of the following...Ch. 19.9 - Prob. 19.18PCh. 19.9 - Compare the structures of vitamin A and vitamin C....Ch. 19.9 - Prob. 19.20PCh. 19.9 - Prob. 19.21KCPCh. 19.9 - Prob. 19.22PCh. 19.9 - Prob. 19.4CIAPCh. 19.9 - Prob. 19.6CIAPCh. 19.9 - Prob. 19.7CIAPCh. 19.9 - Enzyme levels in blood are often elevated in...Ch. 19.9 - Prob. 19.9CIAPCh. 19.9 - Prob. 19.23PCh. 19 - Prob. 19.24UKCCh. 19 - Prob. 19.25UKCCh. 19 - Prob. 19.26UKCCh. 19 - Prob. 19.27UKCCh. 19 - Prob. 19.28APCh. 19 - Explain how the following mechanisms regulate...Ch. 19 - Prob. 19.30APCh. 19 - Prob. 19.31APCh. 19 - Prob. 19.32APCh. 19 - Prob. 19.33APCh. 19 - Prob. 19.34APCh. 19 - Prob. 19.35APCh. 19 - Prob. 19.36APCh. 19 - Prob. 19.37APCh. 19 - Name an enzyme that acts on each molecule. (a)...Ch. 19 - Name an enzyme that acts on each molecule. (a)...Ch. 19 - What features of enzymes make them so specific in...Ch. 19 - Describe in general terms how enzymes act as...Ch. 19 - Prob. 19.42APCh. 19 - Prob. 19.43APCh. 19 - Prob. 19.44APCh. 19 - Prob. 19.45APCh. 19 - Prob. 19.46APCh. 19 - Prob. 19.47APCh. 19 - What is the difference between the lock-and-key...Ch. 19 - Why is the induced-fit model a more likely model...Ch. 19 - Prob. 19.50APCh. 19 - Prob. 19.51APCh. 19 - How do you explain the observation that pepsin, a...Ch. 19 - Prob. 19.53APCh. 19 - Prob. 19.54APCh. 19 - Prob. 19.55APCh. 19 - Prob. 19.56APCh. 19 - Prob. 19.57APCh. 19 - The text discusses three forms of enzyme...Ch. 19 - Prob. 19.59APCh. 19 - Prob. 19.60APCh. 19 - Prob. 19.62APCh. 19 - Prob. 19.63APCh. 19 - The meat tenderizer used in cooking is primarily...Ch. 19 - Prob. 19.65APCh. 19 - Why do allosteric enzymes have two types of...Ch. 19 - Prob. 19.67APCh. 19 - Prob. 19.68APCh. 19 - Prob. 19.69APCh. 19 - Prob. 19.70APCh. 19 - Prob. 19.71APCh. 19 - Prob. 19.72APCh. 19 - Prob. 19.73APCh. 19 - Prob. 19.74APCh. 19 - Prob. 19.75APCh. 19 - Prob. 19.76APCh. 19 - Prob. 19.77APCh. 19 - Prob. 19.78APCh. 19 - Prob. 19.79APCh. 19 - Prob. 19.80CPCh. 19 - Prob. 19.81CPCh. 19 - Prob. 19.82CPCh. 19 - Prob. 19.83CPCh. 19 - Prob. 19.84CPCh. 19 - Prob. 19.85CPCh. 19 - Prob. 19.86CPCh. 19 - Prob. 19.87CPCh. 19 - Prob. 19.88GPCh. 19 - The ability to change a selected amino acid...Ch. 19 - Prob. 19.90GPCh. 19 - Prob. 19.91GP
Additional Science Textbook Solutions
Find more solutions based on key concepts
Using the information listed above, does Earth stay the same distance from the Sun throughout the year? If not,...
Lecture- Tutorials for Introductory Astronomy
1. When is energy most evident?
Conceptual Physics (12th Edition)
Explain all answers clearly, with complete sentences and proper essay structure if needed. An asterisk (*) desi...
The Cosmic Perspective Fundamentals (2nd Edition)
EVOLUTION CONNECTION The percentages of naturally occurring elements making up the human body (see Table 2.1) a...
Campbell Biology (10th Edition)
Work done on a system puts energy into it. Work done by a system removes energy from it. Give an example for ea...
University Physics Volume 1
37. Balance each redox reaction occurring in acidic aqueous solution.
a. K(s) + Cr3+(aq) → Cr(s) + K+(aq)
b. Al...
Chemistry: A Molecular Approach
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Name a nucleoside analog. Explain how that nucleoside analog works. Which viruses are effectively treated by that nucleoside analog?arrow_forwardYou were able to obtain the RNA of the influenza virus. If you injected this into a susceptible host cell could this RNA alone cause a lytic infection? Please explain why or why not with proper reasoning.arrow_forwardTenofovir, an analog of adenosine monophosphate, is a nucleoside reverse transcriptase inhibitor used to treat HIV infection. Atazanavir, also used to treat HIV infection, is a protease inhibitor. Approximately 1 in 1,000 virus particles carries a mutation that confers resistance against any given anti-HIV drug. If there are 1010 virus particles circulating in a patient, roughly how many of them would be resistant to both tenofovir and atazanavir? - 104 - 106 - 107 - 5 x 107 - 1010arrow_forward
- Why can protease inhibitors and nucleoside analogs be used in minimizing the replication of the HIV virus?arrow_forwardIn the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.arrow_forwardWhich of the following statement is false regarding the SARS-CoV-2 protease Mpro? a) Mpro catalyze the translation of viral RNA into polyproteins b) Mpro is an ideal drug target because its structure is largely conserved across the SARS-CoV family c) N3 is an irreversible inhibitor that block the substrate binding site of Mpro d) Mpro forms a dimeric structure and each protomer is composed of three domainsarrow_forward
- Rifampicin attaches to the β subunit of bacterial RNA pol. Why is this used as an antibiotic to treat diseases caused by bacteria?arrow_forwardAzidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cellarrow_forwardGive an example of a nucleoside analogue that has been used successfully as an antiretroviral drug. How does it work thanksarrow_forward
- Why are nucleoside analogs active only against replicating viruses?arrow_forwardWhy are structural analogs of sugar molecules (such as Oseltamivir and zanamivir) effective in treatment of influenza-virus infection?arrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY