CAMPBELL BIOLOGY (LL) >CUSTOM PKG.<
CAMPBELL BIOLOGY (LL) >CUSTOM PKG.<
17th Edition
ISBN: 9781323745618
Author: Central Texas
Publisher: PEARSON C
Textbook Question
Book Icon
Chapter 21, Problem 4TYU

DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four short segments of the FOXP2 protein from six Speeles: chimpanzce (Q, orangutan (()), gorllla (G), rhesus macaque (R), mouse (M), and human (H). These segments contain all of the amino acid differences helween the FOXP2 proteinsof these species.

Chapter 21, Problem 4TYU, DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four

Use a highlighter to color anv amino acid that varies among the species. (Color that amino acid in all sequences.

  1. (a) The C, G, R sequences are identical. Identily which lines correspond to those sequences.
  2. (b) The O sequence differs from the C, G, R speieces at two amino acids. Underilnethetwodlffcrences inthe H sequence.
  3. (c) The O sequence diffen from the C, G, R sequences at one amino acid (having V instead of A) and from the H sequence at three amino acids. Identify tho O sequence.
  4. (d) In the M sequence,circle the amino acid(s) that differ from the C, G, R sequence, and draw a square around those that differ from the H sequence.
  5. (e) Primates and rodents diverged between 60 and IO0 million years ago. and chimpanzees and humans about 6 million years ago. Compare the amino acid differences between the mouse and the C, G, R species with those between the human and the C, G, R species. What can you conclude?
Blurred answer
09:19
Students have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
You discovered a (tiny) novel protein and figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards (showing your work) to identify 2 possible DNA sequences that might encode your protein.            Sequence 1: ______________________________________________________________________            Sequence 2: ______________________________________________________________________     Based on these sequences, is there anything you could infer about where this organism might live? Could the DNA in your possible sequences be beneficial for any particular environments?

Chapter 21 Solutions

CAMPBELL BIOLOGY (LL) >CUSTOM PKG.<

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education