General, Organic, and Biological Chemistry
7th Edition
ISBN: 9781285853918
Author: H. Stephen Stoker
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 22, Problem 22.124EP
The following is a base sequence for an exon portion of a template strand of a DNA molecule:
a. What is the base sequence of the hnRNA strand synthesized from the DNA template strand?
b. What is the base sequence of the mRNA strand synthesized from the hnRNA strand?
c. What codons are present in the mRNA strand produced from the DNA template strand?
d. What tRNA molecule anticodons are needed to interact with the codons present in the mRNA strand produced from the template DNA strand?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given the template DNA sequence:
3’ - TAC - CAG - GTT - ACC - ATC - 5’
A.) What will be the mRNA requence corresponding to the template DNA sequence?
B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.)
C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence?
D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’
1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Chapter 22 Solutions
General, Organic, and Biological Chemistry
Ch. 22.1 - Which of the following statements concerning...Ch. 22.1 - Which of the following statements concerning...Ch. 22.2 - Any given nucleotide in a nucleic acid contains a....Ch. 22.2 - How many different sugars and how many different...Ch. 22.2 - How many different heterocyclic bases that are...Ch. 22.3 - Which of the following is present in nucleotides...Ch. 22.3 - Which of the following is an incorrect statement...Ch. 22.3 - How many of the eight nucleic acid nucleotides are...Ch. 22.3 - Prob. 4QQCh. 22.4 - Prob. 1QQ
Ch. 22.4 - The backbone of a nucleic acid molecule involves...Ch. 22.4 - In a segment of a nucleic acid each nonterminal...Ch. 22.4 - Prob. 4QQCh. 22.4 - Prob. 5QQCh. 22.5 - Prob. 1QQCh. 22.5 - Prob. 2QQCh. 22.5 - Fifteen percent of the bases in a certain DNA...Ch. 22.5 - Which of the following is the correct...Ch. 22.6 - Replication of DNA produces two daughter molecules...Ch. 22.6 - In DNA replication the DNA double helix unwinds...Ch. 22.6 - Prob. 3QQCh. 22.6 - In DNA replication the unwinding of the DNA double...Ch. 22.6 - Prob. 5QQCh. 22.7 - Prob. 1QQCh. 22.7 - Prob. 2QQCh. 22.8 - Prob. 1QQCh. 22.8 - The m in the designation mRNA stands for a. mega...Ch. 22.8 - Prob. 3QQCh. 22.8 - Prob. 4QQCh. 22.9 - Prob. 1QQCh. 22.9 - Prob. 2QQCh. 22.9 - Prob. 3QQCh. 22.9 - Prob. 4QQCh. 22.9 - Prob. 5QQCh. 22.10 - Which of the following statements concerning...Ch. 22.10 - Prob. 2QQCh. 22.10 - Prob. 3QQCh. 22.10 - Prob. 4QQCh. 22.11 - Which of the following is an incorrect pairing of...Ch. 22.11 - Prob. 2QQCh. 22.11 - A tRNA molecule with the anticodon 5 AAG 3 will...Ch. 22.12 - Prob. 1QQCh. 22.12 - Which of the following events is not part of the...Ch. 22.12 - The number of codon binding sites in an...Ch. 22.12 - Prob. 4QQCh. 22.12 - Prob. 5QQCh. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following statements applies to both...Ch. 22.14 - Which of the following statements about a virus is...Ch. 22.14 - Prob. 2QQCh. 22.15 - Prob. 1QQCh. 22.15 - Prob. 2QQCh. 22.15 - The role of E. coli plasmids in obtaining rDNA is...Ch. 22.15 - Prob. 4QQCh. 22.15 - Prob. 5QQCh. 22.16 - Prob. 1QQCh. 22.16 - Each cycle of the polymerase chain reaction a....Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following pentoses is...Ch. 22 - Indicate whether each of the pentoses in Problem...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - How many different choices are there for each of...Ch. 22 - How many different choices are there for each of...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following is a DNA...Ch. 22 - Prob. 22.20EPCh. 22 - Nucleotides containing ribose, thymine, and...Ch. 22 - Prob. 22.22EPCh. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - For the trinucleotide 5 GCA 3 a. How many...Ch. 22 - For the trinucleotide 5 UCG 3 a. How many...Ch. 22 - Is the trinucleotide in Problem 22-31 found only...Ch. 22 - Is the trinucleotide in Problem 22-32 found only...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - Draw the structure of the RNA dinucleotide 5 UG 3.Ch. 22 - Draw the structure of the DNA dinucleotide 5 TA 3.Ch. 22 - For the trinucleotide 5 T-G-A 3 a. How many...Ch. 22 - For the trinucleotide 5 U-C-G 3 a. How many...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following are...Ch. 22 - Indicate whether each of the following are...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - What structural consideration prevents the bases A...Ch. 22 - What structural consideration prevents the bases C...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - For the DNA segment 5 TTGCAC 3 how many of each of...Ch. 22 - For the DNA segment 5 TAGATG 3 how many of each of...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - How does the synthesis of a daughter DNA strand...Ch. 22 - Prob. 22.62EPCh. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.65EPCh. 22 - Prob. 22.66EPCh. 22 - Suppose that 28% of the nucleotides in a DNA...Ch. 22 - Suppose that 30% of the nucleotides in a DNA...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.70EPCh. 22 - Prob. 22.71EPCh. 22 - Prob. 22.72EPCh. 22 - Prob. 22.73EPCh. 22 - Prob. 22.74EPCh. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether each of the following situations...Ch. 22 - Indicate whether each of the following processes...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.81EPCh. 22 - Prob. 22.82EPCh. 22 - For each of the following DNA template strands,...Ch. 22 - Prob. 22.84EPCh. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.86EPCh. 22 - Prob. 22.87EPCh. 22 - Prob. 22.88EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.90EPCh. 22 - Prob. 22.91EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.93EPCh. 22 - Prob. 22.94EPCh. 22 - Prob. 22.95EPCh. 22 - An hnRNA molecule contains three exons, with the...Ch. 22 - Prob. 22.97EPCh. 22 - Indicate whether each of the following...Ch. 22 - Prob. 22.99EPCh. 22 - Prob. 22.100EPCh. 22 - Prob. 22.101EPCh. 22 - Prob. 22.102EPCh. 22 - Prob. 22.103EPCh. 22 - Prob. 22.104EPCh. 22 - Explain why the base sequence ATC could not be a...Ch. 22 - Explain why the base sequence AGAC could not be a...Ch. 22 - Predict the sequence of amino acids coded by the...Ch. 22 - Prob. 22.108EPCh. 22 - Prob. 22.109EPCh. 22 - Prob. 22.110EPCh. 22 - Determine each of the following items using the...Ch. 22 - Determine each of the following items using the...Ch. 22 - Prob. 22.113EPCh. 22 - Prob. 22.114EPCh. 22 - Prob. 22.115EPCh. 22 - Prob. 22.116EPCh. 22 - Prob. 22.117EPCh. 22 - Prob. 22.118EPCh. 22 - Prob. 22.119EPCh. 22 - Which amino acid will a tRNA molecule be carrying...Ch. 22 - Prob. 22.121EPCh. 22 - Prob. 22.122EPCh. 22 - Prob. 22.123EPCh. 22 - The following is a base sequence for an exon...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.126EPCh. 22 - Prob. 22.127EPCh. 22 - Prob. 22.128EPCh. 22 - Prob. 22.129EPCh. 22 - Prob. 22.130EPCh. 22 - Prob. 22.131EPCh. 22 - Prob. 22.132EPCh. 22 - Prob. 22.133EPCh. 22 - Prob. 22.134EPCh. 22 - Consider the following mRNA base sequence 5CUUCAG3...Ch. 22 - Consider the following mRNA base sequence 5ACCCAC3...Ch. 22 - Consider the following DNA base sequence 3TTAATA5...Ch. 22 - Consider the following DNA base sequence 3TATCGG5...Ch. 22 - The DNA template strand segment 3TTCAAACCGTAC5...Ch. 22 - Prob. 22.140EPCh. 22 - Prob. 22.141EPCh. 22 - Prob. 22.142EPCh. 22 - Prob. 22.143EPCh. 22 - Prob. 22.144EPCh. 22 - Prob. 22.145EPCh. 22 - Prob. 22.146EPCh. 22 - Prob. 22.147EPCh. 22 - Prob. 22.148EPCh. 22 - Prob. 22.149EPCh. 22 - Prob. 22.150EPCh. 22 - Prob. 22.151EPCh. 22 - Prob. 22.152EPCh. 22 - Prob. 22.153EPCh. 22 - Prob. 22.154EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.Similar questions
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwarda. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forwardWhich of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forward
- -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTarrow_forwardThe original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.arrow_forward1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequencearrow_forward
- Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardAssume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…arrow_forward1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitutionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY