Fundamentals of General, Organic and Biological Chemistry Volume 1, 5th custom edition for Spokane Community College
1st Edition
ISBN: 9781323562789
Author: John McMurry, David Ballantine, Carl Hoeger
Publisher: Pearson Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 22, Problem 22.83GP
Interpretation Introduction
Interpretation:
The major food sources of galactose in the diet has to be identified.
Concept Introduction:
Galactose is a simple sugar it founded in milk; it is one of the monosaccharide (like simple carbohydrate). It is rarely found in nature or in foods as it is commonly found linked with glucose, forming the disaccharide lactose.
Galactose pathway
- Galactose is a monosaccharide
- The lactose is sugar that is found in many foods, when the lactose is broken down in the body, glucose and galactose are produced.
- Galactose is converted into glucose in the body for energy purpose in the Leloir pathway.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
One example of a stage 1 reaction in the heterotrophic breakdown of food molecules is:
the intramitochondrial digestion of pyruvate into carbon dioxide and water
the intramitochondrial digestion of fatty acids into carbon dioxide and water
the extracellular digestion of triglycerides into fatty acids and glycerol
the intracellular digestion of some amino acids into NH4+ and pyruvate
the intracellular digestion of glucose monomers into pyruvate
Which of the following is an active form of glucose to initiate the process of glycogenesis?
Select one:
a. AMP glucose
 b. Glucose-1-phosphate
c. UDP glucose
 d. Adenosyl glucose
Which of the following statements concerning glycogen in different tissues is TRUE?
Â
a.
Â
Liver glycogen serves as a fuel reserve for ATP synthesis during muscle contraction.
Â
b.
Brain glycogen serves as a source of blood glucose.
c.
Red blood cells use glycogen as a source of blood glucose.
d.
Muscle glycogen serves as a fuel reserve for ATP synthesis during muscle contraction.
e.
Muscle glycogen serves as a source of blood glucose.
Chapter 22 Solutions
Fundamentals of General, Organic and Biological Chemistry Volume 1, 5th custom edition for Spokane Community College
Ch. 22.2 - Prob. 22.1PCh. 22.2 - Prob. 22.2PCh. 22.3 - Prob. 22.3PCh. 22.3 - Prob. 22.4PCh. 22.3 - Prob. 22.5PCh. 22.3 - Prob. 22.6KCPCh. 22.4 - Prob. 22.1CIAPCh. 22.4 - Prob. 22.2CIAPCh. 22.4 - Prob. 22.3CIAPCh. 22.4 - Explain the chemical process that leads to...
Ch. 22.4 - Prob. 22.5CIAPCh. 22.4 - Prob. 22.7PCh. 22.4 - Prob. 22.8PCh. 22.5 - In alcoholic fermentation, each mole of pyruvate...Ch. 22.5 - Name three ways humans have exploited the ability...Ch. 22.5 - Pyruvate has three different fates. What are the...Ch. 22.6 - Prob. 22.12PCh. 22.6 - Prob. 22.13PCh. 22.7 - Prob. 22.14PCh. 22.7 - Prob. 22.15PCh. 22.7 - Prob. 22.16KCPCh. 22.7 - Prob. 22.6CIAPCh. 22.7 - Prob. 22.7CIAPCh. 22.7 - Prob. 22.8CIAPCh. 22.8 - Prob. 22.17PCh. 22.8 - Prob. 22.18PCh. 22.9 - Prob. 22.19PCh. 22.9 - Prob. 22.20PCh. 22.9 - Prob. 22.21PCh. 22.9 - Prob. 22.9CIAPCh. 22.9 - Prob. 22.10CIAPCh. 22.9 - Prob. 22.11CIAPCh. 22.9 - Prob. 22.12CIAPCh. 22 - What class of enzymes catalyzes the majority of...Ch. 22 - Prob. 22.23UKCCh. 22 - Prob. 22.24UKCCh. 22 - Prob. 22.25UKCCh. 22 - Classify each enzyme of glycolysis into one of the...Ch. 22 - Prob. 22.27UKCCh. 22 - Name the molecules used for gluconeogenesis. What...Ch. 22 - Prob. 22.31APCh. 22 - Prob. 22.32APCh. 22 - Prob. 22.33APCh. 22 - Prob. 22.34APCh. 22 - Prob. 22.35APCh. 22 - Prob. 22.36APCh. 22 - Prob. 22.37APCh. 22 - Prob. 22.38APCh. 22 - Prob. 22.39APCh. 22 - Prob. 22.40APCh. 22 - Prob. 22.41APCh. 22 - Prob. 22.42APCh. 22 - Prob. 22.43APCh. 22 - Prob. 22.44APCh. 22 - Prob. 22.45APCh. 22 - Review the 10 steps in glycolysis (Figure 22.3)...Ch. 22 - Prob. 22.47APCh. 22 - Prob. 22.49APCh. 22 - Prob. 22.50APCh. 22 - Prob. 22.51APCh. 22 - How many moles of acetyl-CoA are produced by the...Ch. 22 - Prob. 22.53APCh. 22 - Prob. 22.54APCh. 22 - Prob. 22.55APCh. 22 - Prob. 22.56APCh. 22 - Prob. 22.57APCh. 22 - Prob. 22.58APCh. 22 - Prob. 22.59APCh. 22 - Why does glycogenolysis use fewer steps than the...Ch. 22 - Prob. 22.61APCh. 22 - Prob. 22.62APCh. 22 - Prob. 22.63APCh. 22 - Prob. 22.64APCh. 22 - Prob. 22.65APCh. 22 - Prob. 22.66APCh. 22 - Prob. 22.67APCh. 22 - Prob. 22.68APCh. 22 - Why can pyruvate cross the mitochondrial membrane...Ch. 22 - Look at the glycolysis pathway (Figure 22.3). With...Ch. 22 - Prob. 22.71CPCh. 22 - Prob. 22.72CPCh. 22 - Prob. 22.74CPCh. 22 - Prob. 22.75CPCh. 22 - Prob. 22.76CPCh. 22 - Why is it important for the cell that the NADH...Ch. 22 - Prob. 22.78CPCh. 22 - Prob. 22.79CPCh. 22 - Prob. 22.80CPCh. 22 - Prob. 22.81CPCh. 22 - Prob. 22.82GPCh. 22 - Prob. 22.83GPCh. 22 - It is important to avoid air when making wine, so...Ch. 22 - Prob. 22.85GP
Knowledge Booster
Similar questions
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardWhich one of the following compounds cannot give rise to the net synthesis of Glucose? a. Lactate b. Alanine c. Glycerol d. Acetyl CoAarrow_forwardWhich of the following is a substrate for glycogen synthase? a. UTP-glucose b. Glucose 1-phosphate c. CDP-glucose d. UDP-glucosearrow_forward
- Which of the following statements about glucose metabolism is correct?  A. Glucagon increases the rate of glycolysis B. Glycolysis requires NADP+ C. In glycolysis, glucose is cleaved into two three-carbon product D. The end-product of glycolysis in red blood cells is pyruvate E. Glycogen is synthesized in the liver in response to insulin and exported to other tissues for use as a metabolic fuelarrow_forwardWhich of the following enzymes is NOT required to glycogen synthesis? a. branching Enzymes b. UDP-glucose pyrophosphorylase c. glycogen synthase d. glycogen phosphorylasearrow_forwardWhat must occur before a fatty acid can be metabolized by cellular respiration? A)The fatty acids must be linked to glycerol and form a neutral fat. B)The fatty acid must be broken down into acetic acid, a two-carbon molecule. C)The fatty acid chain must be broken down into three-carbon molecules, pyruvic acid. D)The fatty acid must be broken down into amino acids before they can enter the Krebs cycle.arrow_forward
- One example of a stage 2 reaction in the heterotrophic breakdown of food molecules is: the extracellular digestion of amylopectin into glucose monomers the intramitochondrial digestion of fatty acids into carbon dioxide and water the intracellular digestion of glucose monomers into pyruvate the extracellular digestion of triglycerides into fatty acids and glycerol the extracellular digestion of polypeptides into amino acids  Identify the three-carbon glycolysis intermediate which can be formed, in the cytoplasm, in one enzymatic step (during deamination of the amino acid alanine)? pyruvate fructose-1,6-bisphosphate fructose glucose-6-phosphate glucosearrow_forwardWhich of the following statements is a lie? Select one: a.Energy is released when the terminal phosphate group is removed, known as dephosphorylation, whereas energy is needed when a phosphate group is added, also known as phosphorylation. b.A living organism has an unlimited supply of energy. c.Energy mediated by ATP comes from the metabolism of different isomers of C6H12O6 (sugar), such as glucose, fructose, and galactose.  Which of the following statements is a lie? Select one: a.The transfer of energy in living systems use electrons to allow the cell to transfer energy in large amounts. b.Electrons play an important role in redox reactions. This is true because it is the electrons that undergo the redox reactions in living systems. c.For nicotinamide adenine (NAD), its oxidized form is NAD+ while its reduced form is NADH. This is true because NAD+ can accept electrons from an organic molecule.arrow_forwardWhich carbons of Glucose 1-Phosphate will be incorporated into Lauric acid (C-12) by the Fatty Acid Synthase? (One or multiple answers)  a. Carbon 1 b. Carbon 2 c. Carbon 3 d. Carbon 4 e. Carbon 5 f. Carbon 6 g. All carbons will be incorporated. h. No carbons will be incorporatedarrow_forward
- A new energy drink in stores contains no sugar, carbs or fat. It does, however, contain relatively high concentrations of B-vitamins (B-3, B-5, B-6, and B-12) which our digestive system does not break down. If our useable energy (ATP) is supplied by cellular respiration, where would the energy this products claims to provide come from?arrow_forwardWhich of the following is an important end product of disassembly of fatty acids? answer choices A.) DNA gyrase B.) Pyruvate C.) Acetyl CoA D.) Succinate dehydrogenasearrow_forwardfill in the blank with the correct term and explain why that term fits best to the following , one reason to phosphorylate glucose is to increase the number of available noncovalent interactions between the phosphorylated sugar and the enzymes, thus increasing the ____________.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON