Concept explainers
ALS (amyotrophic lateral sclerosis) is a rare, fatal neurodegenerative disease that is genetically complex. During the last several years, using GWAS analyses and other methods, 11 different genes have been identified that are thought to be connected with ALS. The most recently discovered of these genes, TBK1, was identified through analysis of the whole exome sequences of several thousand Cases and Controls. Recall from Chapter 11 that the exome is the approximately 1% of the human genome that corresponds to exons. Each person’s exome sequence was evaluated on a gene-by-gene basis as to whether or not a SNP variant likely to alter gene function was present. The TBK1 gene was not identified in previous GWAS analyses that genotyped similar numbers of individuals for common SNPs. Cite possible explanations for the different outcomes of these two experiments.
Want to see the full answer?
Check out a sample textbook solutionChapter 22 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
- The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwardA research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…arrow_forwardLeber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…arrow_forward
- Which of the following conditions is most likely to be successfully treated by gene therapy using a viral vector to deliver a wild-type copy of one gene that is present in mutant form in a person with the condition? Assume that the viral vector used has the ability to home to relevant target tissues. Also assume that the patient can be treated at a young enough age to avoid irreversible phenotypic impacts of the mutation described. Timothy Syndrome, a multi-system disorder characterized by dysmorphic features and autistic behavioral traits, caused by overexpression of calcium channel gene Cerebral adrenoleukodystrophy (ALD), a neurological disorder caused by a frameshift mutation knocking out the function of the ABCD1 gene encoding a lipid transporter Osteogenesis imperfecta caused by a dominant negative mutation in the collagen A1 gene Myopia (shortsightedness), a vision impairment with heritability estimates in the range of 0.6-0.8, where risk is impacted by at least 200 genesarrow_forwardDifferent mutations in the WDR62 gene that inactivate gene function were found in the genomes of many different people with microcephaly. This information provided strong support for the idea that the WDR62 gene mutation causes microcephaly. The human genome sequence identified WDR62 as one of the approximately 27,000 genes in the human genome. What information about the function of WDR62 do you think was learned originally from the DNA sequence of the normal human genome? What additional information was provided by identification of WDR62 as the microcephaly disease gene?arrow_forwardBelow is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…arrow_forward
- To detect the CAG repeat expansion with a particular gene where 30 repeats in Normal changes to 250 repeats in a certain disease, how can we diagnose the condition. How To identify Y chromosome microdeletion ( which involves the deletion of AZF locus) using conventional karyotyping? If not then why. How will you diagnose a chromosomal translocation event?arrow_forwardA 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.arrow_forwardThe accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)arrow_forward
- If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…arrow_forwardLeber congenital amaurosis (LCA) is a form of congenital blindness in humans and is known to be caused by homozygosity for recessive mutations in the RPE65 gene. Recently, a rare dominant mutation in RPE65 has been implicated as one cause of an eye disease called retinitis pigmentosa, which is characterized by retinal degeneration that can progress to blindness. The dominant RPE65 mutation is a missense mutation causing amino acid 447 in the polypeptide to change from Asp to Glu. Little is known about the nature of the mutant protein. a. Do you think that the dominant allele is more likely a loss-of-function or a gain-of-function mutation? Explain. b. Recently a group of clinicians and scientists reported that gene therapy (gene replacement therapy) for LCA has been at least partially successful. Do you think that the same kind of gene therapy can be used for patients with retinitis pigmentosa caused by the dominant mutant allele of RPE65? Explain.arrow_forwardYou learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education