GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 24, Problem 10EQ
In this chapter, we considered a computer program that translates a DNA sequence into a polypeptide sequence. Instead of running this program, a researcher could simply look the codons up in a genetic code table and determine the sequence by hand. What are the advantages of running the program rather than doing the translation the old-fashioned way, by hand?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
DNA mutations can affect the
reading frame for the genetic
code. What is a human
condition caused by these
mutations? Identify how the
reading frame is affected.
In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space
The polypeptide sequence is:
if there are multiple start condo, how can you identify the real start codon?a) By observing Okazaki fragmentsb) By identifying splicing sitec) Using sequence data basesd) By identifying Kozak sequence
Chapter 24 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The mRNA sequence is:arrow_forwardThe code for a fully functional protein is actually coming from an mRNA transcript that has undergone post-transcriptional processing which is essentially way too different from the original code in the DNA template. Given: GUC-CAC-UUA-ACC-CCU-GAG-GAG-AAA-UCG-GCC (Protein with known amino acid sequence) Requirement: Original DNA code. Itemize the steps you would take to get to know the original DNA code of the protein in focus.arrow_forwardWhich of the following types of enzymes is primarily responsible for setting up the genetic code? 1.) Kinases 2.) DNA ligase 3.) DNA gyrase 4.) peptidyl transferase 5.) aminoacyl tRNA synthetases (charging enzymes)arrow_forward
- You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its genetic code. You isolate the translation machinery from this organism and use it to translate (in a test tube) some RNA sequences that you have generated. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. Assume 3 bases = a codon. One of the mRNAs that you add to the test tube has this sequence: 5’ACUACUACUACUACU… 3’ (The dots indicate that the previous sequence repeats.) If the new organism uses the same genetic code as other organisms on Earth, what polypeptide(s) would you expect as a result in this experiment? a)Leu-Leu-Leu… and Tyr-Tyr-Tyr… b)Thr-Thr-Thr… c) Leu-Leu-Leu… and Ser-Ser-Ser… and Tyr-Tyr-Tyr… d)Thr-Leu-Tyr-Leu… e)Thr-Thr-Thr… and Leu-Leu-Leu… and Tyr-Tyr-Tyr…arrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardThe image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?arrow_forward
- Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forwardlook at the code: import random # Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"] # Define the codon-to-amino acid dictionarycodon_table = { "AUG": "M", # Start codon "UUU": "F", "UUC": "F", "UUA": "L", "UUG": "L", "UCU": "S", "UCC": "S", "UCA": "S", "UCG": "S", "UAU": "Y", "UAC": "Y", "UAA": "*", # Stop codon "UAG": "*", # Stop codon "UGU": "C", "UGC": "C", "UGA": "*", # Stop codon "UGG": "W", "CUU": "L", "CUC": "L", "CUA": "L", "CUG": "L", "CCU": "P", "CCC": "P", "CCA": "P", "CCG": "P", "CAU": "H", "CAC": "H", "CAA": "Q", "CAG": "Q", "CGU": "R", "CGC": "R", "CGA": "R", "CGG": "R", "AUU": "I", "AUC": "I", "AUA": "I", "AUC": "I", "ACU": "T", "ACC": "T", "ACA": "T", "ACG": "T", "AAU": "N", "AAC": "N", "AAA": "K", "AAG": "K", "AGU": "S", "AGC": "S", "AGA": "R", "AGG": "R", "GUU": "V", "GUC": "V", "GUA": "V",…arrow_forwardWe have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tabloarrow_forward
- The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forwardIt is known that the second amino acid in that protein is argınine, and if we zoom in and look in the genome browser at where the second codon is encoded, we see the DNA sequence 5-CCT-3. Are we looking at the coding strand or the template strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license