GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 15EQ
Summary Introduction
To analyze:
The given sequence of
Introduction:
Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What organism produced this gene sequence? Provide the full genus and species name. Make
sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.)
>Sequence2c
GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC
If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
Identify the MRNA sequence that encodes the protein
Design primers that will allow them to amplify the gene sequence using PCR.
Chapter 24 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Follow these directions to access the entries for PTGS1 and PTGS2 in the “Gene” database at the NCBI Website:A. First, go to the NCBI homepage using the link on the lab webpage, or by going to: http://www.ncbi.nlm.nih.gov Select “Gene” from the database pulldown menu. Type “PTGS” in the search box, then click “Go.” Scan the results for the “Homo sapiens” entries. There should be one called “PTGS1” and one called “PTGS2.” Select each entry by clicking on its name, then read the paragraph under the “Summary” section for each entry. The drug Celebrex selectively inhibits PTGS2 while aspirin and other NSAID’s inhibit both PTGS1 and PTGS2 in the same way. Why do you think researchers wanted to discover a selective inhibitor to PTGS2? 2. Describe how studying 3-D structures of PTGS1 and PTGS2 could help researchers design a drug that binds to PTGS1, but not to PTGS2.arrow_forwardPlace the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into their correct order. Reset MAAAAAAAAAKK MAAAAAAAAAAM Compare sequences to known genome sequence. Create cDNA using reverse transcription with primers complementary to linkers. Attach linkers to the ends of the RNAs. Perform next-generation DNA sequencing. Isolate RNA from cells or tissues of interest. Fragment the RNAs.arrow_forwardAnnotation involves identifying genes and gene-regulatory sequences in a genome. List and describe characteristics of a genome that are hallmarks for identifying genes in an unknown sequence. What characteristics would you look for in a bacterial genome? A eukaryotic genome?arrow_forward
- What are the two advantages of using sequence analysis of ribosomal components in determining the relatedness of organisms? please explain why each is an advantage.arrow_forwardWhat are the particular changes in the gene and protein sequences shown on the screen? Name the codons and amino acids.arrow_forwardDiscuss why it is useful to search a database to identify sequencesthat are homologous to a newly determined sequence.arrow_forward
- The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy. Explain what they are used for. Also mention the actual biological function of the respective enzymes. 1) RNaseHarrow_forwardWhat is a database? What types of information are stored within adatabase? Where does the information come from? Discuss theobjectives of a genome database.arrow_forwardSouthern blotting is a method used in molecular biology for detection of a specific DNA sequence in DNA samples while northern blotting is used for the detection of RNA in a sample. Write down the similarities and differences between both methods.arrow_forward
- What are three benefits Ion torrent sequencing has over sanger sequencingarrow_forwardDescribe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced fragments below, to determine the order of the fragments and the complete sequence.arrow_forwardCompare the composition of genes and upstream regions of DNA in bacteria, Archaea and eukaryotes in table formatarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license