Biology
Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 24, Problem 3IQ
Summary Introduction

To determine: The findings of the gene transcription features in the genomes of apes and humans.

Introduction: DNA replication takes place before the cell division and prepares the cell for mitosis and meiosis. This process is followed by transcription and translation. Genetic testing is one of the most useful tools in diagnostics to identify genetic abnormalities. It helps to detect the presence of any heritable malformation carried through the genetic makeup of the parents to the offspring.

Blurred answer
Students have asked these similar questions
There is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)
What is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive.  It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.   You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?               You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?     5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’         After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license