FUND. GEN. ORG&BIO CHEM PKG
FUND. GEN. ORG&BIO CHEM PKG
2nd Edition
ISBN: 9781323447345
Author: McMurry
Publisher: PEARSON C
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 26, Problem 26.66AP
Interpretation Introduction

Interpretation:

For the synthesis of metenkephalin, the mRNA sequence has to be synthesized.

Concept Introduction:

Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-nucleotide sequence that is a stop codon and stops translation.

Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.

FUND. GEN. ORG&BIO CHEM PKG, Chapter 26, Problem 26.66AP

Illustrated relationships are:

DNA informational strand: 5’ ATG  CCA   GTA  GGC  CAC   TTG   TCA  3’

DNA Template strand:         3’ TAC  GGT   CAT  CCG  GTG   AAC   AGT  5’

mRNA:                                  5’ AUG  CCA  GUA  GGC  CAC  UUG   UCA  3’

protein:                                       Met    Pro     Val    Gly     His    Leu      Ser

Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.

Blurred answer
Students have asked these similar questions
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon.   The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon.   There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon.   all of the above

Chapter 26 Solutions

FUND. GEN. ORG&BIO CHEM PKG

Ch. 26.4 - Prob. 26.11KCPCh. 26.6 - What are Okazaki fragments? What role do they...Ch. 26.6 - Prob. 26.13PCh. 26.8 - Prob. 26.14PCh. 26.8 - Prob. 26.15PCh. 26.9 - Prob. 26.1CIAPCh. 26.9 - Prob. 26.2CIAPCh. 26.9 - Using a variety of sources, research which...Ch. 26.9 - Prob. 26.4CIAPCh. 26.9 - List possible codon sequences for the following...Ch. 26.9 - Prob. 26.17PCh. 26.9 - What amino acids do the following sequences code...Ch. 26.9 - Prob. 26.19PCh. 26.10 - Prob. 26.20PCh. 26.10 - What anticodon sequences of tRNAs match the mRNA...Ch. 26 - Combine the following structures to create a...Ch. 26 - Prob. 26.23UKCCh. 26 - Copy the following simplified drawing of a DNA...Ch. 26 - Prob. 26.25UKCCh. 26 - Prob. 26.26UKCCh. 26 - Prob. 26.27APCh. 26 - Prob. 26.28APCh. 26 - Prob. 26.29APCh. 26 - Prob. 26.30APCh. 26 - Prob. 26.31APCh. 26 - For the following molecule: (a) Label the three...Ch. 26 - Prob. 26.33APCh. 26 - Prob. 26.34APCh. 26 - Prob. 26.35APCh. 26 - Prob. 26.36APCh. 26 - Draw structures to show how the sugar and...Ch. 26 - What is the difference between the 3 end and the 5...Ch. 26 - Prob. 26.39APCh. 26 - Prob. 26.40APCh. 26 - Draw the complete structure of the RNA...Ch. 26 - Prob. 26.42APCh. 26 - Prob. 26.43APCh. 26 - Prob. 26.44APCh. 26 - Prob. 26.45APCh. 26 - If a double-stranded DNA molecule is 22% G, what...Ch. 26 - How are replication, transcription, and...Ch. 26 - Why is more than one replication fork needed when...Ch. 26 - Prob. 26.49APCh. 26 - What are the three main kinds of RNA, and what are...Ch. 26 - Prob. 26.51APCh. 26 - Prob. 26.52APCh. 26 - Prob. 26.53APCh. 26 - Prob. 26.54APCh. 26 - What is a codon and on what kind of nucleic acid...Ch. 26 - Prob. 26.56APCh. 26 - Prob. 26.57APCh. 26 - Prob. 26.58APCh. 26 - What amino acids are specified by the following...Ch. 26 - Prob. 26.60APCh. 26 - What anticodon sequences are complementary to the...Ch. 26 - Prob. 26.62APCh. 26 - Refer to Problem 26.62. What sequence appears on...Ch. 26 - Refer to Problems 26.62 and 26.63. What dipeptide...Ch. 26 - Prob. 26.65APCh. 26 - Prob. 26.66APCh. 26 - Prob. 26.67APCh. 26 - Prob. 26.68APCh. 26 - Prob. 26.69APCh. 26 - Prob. 26.70CPCh. 26 - Prob. 26.71CPCh. 26 - Prob. 26.73CPCh. 26 - Prob. 26.75GPCh. 26 - Prob. 26.76GPCh. 26 - Prob. 26.77GPCh. 26 - Prob. 26.78GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY