Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 26, Problem 7U
Summary Introduction
Introduction: Prions are the proteinaceous infectious particles that lack
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Even when a gene is available and its sequence of nucleotides is known, chemical studies of the protein are still required to determine:
a. molecular weight of the unmodified protein.
b. the amino-terminal amino acid.
c. the location of disulfide bonds.
d. the number of amino acids in the protein.
e. whether the protein has the amino acid methionine in its sequence.
For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Chapter 26 Solutions
Biology
Ch. 26.1 - Prob. 1LOCh. 26.1 - Prob. 2LOCh. 26.2 - Prob. 1LOCh. 26.2 - Prob. 2LOCh. 26.3 - Prob. 1LOCh. 26.3 - Describe how viruses can contribute DNA to their...Ch. 26.4 - Describe the differences between acute and...Ch. 26.4 - Prob. 2LOCh. 26.4 - Prob. 3LOCh. 26.5 - Prob. 1LO
Ch. 26 - Prob. 1UCh. 26 - Prob. 2UCh. 26 - Prob. 3UCh. 26 - Prob. 4UCh. 26 - Why is a drug that blocks HIV binding to one of...Ch. 26 - Prob. 6UCh. 26 - Prob. 7UCh. 26 - Prob. 1ACh. 26 - Prob. 2ACh. 26 - Prob. 3ACh. 26 - Prob. 4ACh. 26 - Prob. 5ACh. 26 - Prob. 6ACh. 26 - Prob. 7ACh. 26 - E. coli lysogens derived from infection by phage ...Ch. 26 - Prob. 2SCh. 26 - Prob. 3SCh. 26 - Prob. 4SCh. 26 - Prob. 5S
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forward1. Identify the term being asked by the statement: a. It describes mRNA that results in a single translation of several genes at a time. b. It guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. These are Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand. d. It is a A secondary structure in proteins where the amino acid chains aligned side-by-side with every other chain situated opposite the other, with chains being held together by hydrogen bondsarrow_forwardArrange the statements in their proper order by writing the corresponding letter (e.g. A) for each statement in the space provided below. A. The single-stranded RNA would complement the target RNA. B. Gene expression is inactivated once the mRNA is no longer accessible for translation. C. The risk-induced silencing complex which is composed of RNA and protein subunits is formed. D. Double-stranded, non-coding RNA is cleaved by Dicer. E. The mRNA can be cleaved or remain bound by the RISC. 1. 2. 3. 4. 5.arrow_forward
- There are 61 mRNA codons that specify an amino acid, but only 45 tRNAs. This is best explained by the fact that A. some tRNAs have anticodons that recognize two or more different codons. B. the rules for base pairing between the third base of a codon and tRNA are flexible. C. many codons are never used, so the tRNAs that recognize them are dispensable. D. A and B only E. A, B, and Carrow_forwardA geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells? Possible Answers: A. The mRNA will be spliced, but will not have a 5' cap. B. The mRNA will likely be degraded. C. The mRNA will not be cleaved. D. The mRNA will have too many Gs and Cs.arrow_forwardIf an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing transcripts that will potentially encode proteins with different primary structures. I. the MRNA is found in a bacterial cell. II. transcription and translation of the MRNA will occur simultaneously. the alternative splicing happened in the cytoplasm. IV. Ay different exons from a pre-mRNA will be spliced together. V. the different MRNAS will all have poly-A tails. VI.arrow_forward
- Which of the following are elongation factors involved in the release of free tRNAs? a.EF-G b.EF-Ts c.EF-Tu d.EF-Parrow_forwardThe idea that primary sequence determines tertiary structure first came from experiments in the 1950's about: A. the renaturation of RNaseA (ribonuclease A). B. the denaturation of lysozyme. C. the 3D structure of lysozyme. D. the role of Hsp70 in protein folding. E. the role of PDI (protein disulfide isomerase) in protein folding.arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- The anticodon of a tRNA is 5’ AAU 3' a. What codon does the tRNA recognize? b. What amino acid does it carry? c. Suppose a mutation occurs in the gene encoding for the tRNA that converts the anticodon to 5' ACU 3'. Would this have a negative effect, positive effect or neutral effect on a cell? Explain and include "phenotype" in your answer.arrow_forward(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…arrow_forwardPlease consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B, C and/or D to answer the question. C. What terminus of the protein is represented by the amino acid represented by label D?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY