BIOLOGY (LL)
BIOLOGY (LL)
5th Edition
ISBN: 9781264115495
Author: BROOKER
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 26.3, Problem 1CS

Core Skill: Modeling The goal of this modeling challenge is to revise the model shown in Figure 26.22 to account for recent data indicating that some modern Africans have a small amount of Neanderthal DNA.

Modeling Challenge: As discussed in this section, between 1% and 4% of the DNA of modern humans of European descent is derived from that of Neanderthals. Though most modern humans of African descent do not carry Neanderthal DNA, recent evidence has shown that some of them carry a very small amount. Assuming that the presence of this Neanderthal DNA is not due to recent interbreeding between modern humans of European and African descent, revise the model shown in Figure 26.22 to account for the observation.

Chapter 26.3, Problem 1CS, Core Skill: Modeling The goal of this modeling challenge is to revise the model shown in Figure

Figure 26.22 A simplified model for the origin and spread of Homo sapiens throughout the world. This map, based on differences of mtDNA throughout current members of the world’s population, suggests Homo sapiens originated in East Africa. About 100,000 years ago, the species spread into the Middle East and from there to Europe, Asia, Australia, and the Americas.

Blurred answer
Students have asked these similar questions
Exercise 3. Create a phylogeny to try to understand the evolutionary history of mammals related to the giant panda using the gene Leptin. Introduction: Did you know that it is required that every gene that is sequenced and published must be made fully accessible on the internet. What that means is you can look up any gene online. Today we will use the NCBI website: The National Center for Biotechnology Information to first find a gene in giant Pandas and then we will use a feature on the NCBI website called BLAST which measures the degree of gene sequence similarity between various types of organisms. Once we have identified these gene sequences we will use them to build a phylogeny to figure out which animals are most closely related to giant Pandas. 1. First make a guess and label this phylogenetic tree to include: Giant Pandas, Bears, Sea Lions and Cats. Showing which are most closely related to one another: 1 2-Now do a search on the gene Leptin. What is its function? Regulation of…
Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and species of the following DNA sequence: TATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATG Gene: Insulin Receptor (INSR), Species: Mus Musculus Gene: Insulin Receptor (INS), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Homo Sapiens Gene: Epidermal Growth Factor Receptor (EGFR), Species: Mus Musculus
What is DNA fingerprinting? what is its application/s (legally and medically) and limitation/s? How does this technology work? i.e in genomic DNA identification? What is its molecular basis? How does molecular biology paved way for the emergence of this technology?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Phylogenetic Mysteries: Crash Course Zoology #12; Author: CrashCourse;https://www.youtube.com/watch?v=cVaw7nF72Aw;License: Standard youtube license