Prescott's Microbiology
11th Edition
ISBN: 9781260409062
Author: WILLEY, Joanne
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 26.3, Problem 1MI
Why is the ϕX174 genome considered plus stranded?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype
of individual 2?
941 bp
641 bp->>>
1 2 3 4 5 6
Homozygous for the 641 bp sequence that does not contain in the Alu insertion
Heterozygous, containing one 941 bp sequence and one 641 bp sequence
O Homozygous for the 941 bp sequence containing the Alu insertion
this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever.
the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand.
Sequence to be amplified:
5’- GGTATTGGCTACTTACTGGCATCG- 3’
3’- CCATAACCGATGAATGACCGTAGC- 5’
Primers: 5’-TGGC-3’ and 5’-TGCC-3’
Chapter 26 Solutions
Prescott's Microbiology
Ch. 26.1 - List some characteristics used in classifying...Ch. 26.1 - Prob. 2CCCh. 26.2 - Prob. 1MICh. 26.2 - Why do you think T4 evolved to initiate DNA...Ch. 26.2 - What function does HMC glycosylation serve?Ch. 26.2 - Explain why the T4 genome is circularly permuted.Ch. 26.2 - Prob. 1.2CCCh. 26.2 - How is a prophage induced to become active again?Ch. 26.2 - Describe the roles of cII, CIII, repressor (CI),...Ch. 26.2 - How do the temperate phages Mu and P1 differ from...
Ch. 26.2 - How is the envelope of this virus formed? How does...Ch. 26.2 - Why do cold sores recur throughout the lifetime of...Ch. 26.2 - In what part of the host cell does a herpesvirus...Ch. 26.2 - Many small DNA viruses rely on host enzymes for...Ch. 26.3 - Why is the X174 genome considered plus stranded?Ch. 26.3 - Why is it necessary for some ssDNA viruses to...Ch. 26.3 - Prob. 2CCCh. 26.3 - How do parvoviruses trick the host DNA polymerase...Ch. 26.4 - The rotavirus genome encodes 12 proteins. Suggest...Ch. 26.4 - Describe the life cycle of 6 phage. What makes...Ch. 26.4 - Prob. 3CCCh. 26.4 - In what ways are the life cycles of 6 and...Ch. 26.5 - Where in the host does the plus-strand RNA genome...Ch. 26.5 - How do some plus-strand viruses use polyproteins...Ch. 26.5 - What is an IRES? Why is it important?Ch. 26.5 - Prob. 3CCCh. 26.6 - How does that use of a segmented genome by...Ch. 26.6 - Prob. 2CCCh. 26.7 - Prob. 1MICh. 26.7 - Prob. 1CCCh. 26.7 - Prob. 2CCCh. 26.7 - Prob. 3CCCh. 26.8 - Prob. 1CCCh. 26.8 - Trace the HBV multiplication cycle, paying...Ch. 26 - Prob. 1RCCh. 26 - Prob. 2RCCh. 26 - Prob. 3RCCh. 26 - Prob. 4RCCh. 26 - No temperate RNA phages have yet been discovered....Ch. 26 - The choice between lysogeny and lysis is...Ch. 26 - Prob. 3ALCh. 26 - You are studying RNA viruses and have discovered a...Ch. 26 - Prob. 5ALCh. 26 - Prob. 6AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Are forward and reverse primer are complementry to each other ?arrow_forwardBelow is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.arrow_forwardPrimer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgccccccarrow_forward
- Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…arrow_forwardWhy does transposition always produce direct repeats in the chromosomalDNA?arrow_forwardWhat is true regarding the following cross between bacterial strains: F’ x F-? As the donor, F' will donate only the F plasmid to F- As the donor, F- will donate the F plasmid only to F' As the donor, F- will donate the F plasmid and a portion of the bacterial chromosome to F' As the donor, F' will donate the F plasmid and a portion of the bacterial chromosome to F-arrow_forward
- For the following sequence please design an 18 base pair REVERSE primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAAarrow_forwardA closed circular plasmid B-DNA (10.5 bp/turn) consists of 231 base pairs and has Wr= -1 (ccDNAa). Then a topoisomerace acts upon ccDNAa leading to strain relaxation caused by supercoiling, thus, a topoisomere ccDNAb is formed. Finally, EtBr (Ethidium bromide) intercalator is added leading to ccDNAc which has 11bp/turn. a) Calculate superhelical densities σa, σb, σc of the three plasmids ccDNAa, ccDNAb and ccDNAc, respectively. b) Which of the three topoisomeres will move faster in agarose gel electrophoresis and why?arrow_forwardPlease help mearrow_forward
- In a transformation experiment, donor DNA was obtained from a prototroph bacterial strain (x* y z'), and the recipient was a triple auxotroph (x y z ). The following transformant classes were obtained: x* y z xy'z 160 130 190 170 x'y 3 xy x'y 5 What general conclusions can you draw about the linkage relationships among the three genes?arrow_forwardIn Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?arrow_forwardHomologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases. Why are these mismatches not eliminated bythe mismatch repair system?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license