Fund. of General, Org... -Masteringchem.
Fund. of General, Org... -Masteringchem.
8th Edition
ISBN: 9780134143330
Author: McMurry
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 27, Problem 27.34AP
Interpretation Introduction

Interpretation:

The severity of DNA mutation that produced in the following changes in mRNA codons has to be compared.

Concept Introduction:

Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when DNA replication takes place.

Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.

Some amino acids and their corresponding mRNA codons are listed below,

AminoacidmRNAcodonsAla_nineGCU,GCC,GCA,GCGTyr_osineUAU,UACVal_ineGUU,GUC,GUA,GUGHis_tidineCAU,CACSer_ineUCU,UCC,UCA,UCGCys_teineUGU,UGCPro_lineCCU,CCC,CCA,CCG

Start codon is a codon that specifies the start of RNA translation.

Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.

Blurred answer
Students have asked these similar questions
explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codon
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’

Chapter 27 Solutions

Fund. of General, Org... -Masteringchem.

Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY